Incidental Mutation 'R0357:Ift172'
ID 29872
Institutional Source Beutler Lab
Gene Symbol Ift172
Ensembl Gene ENSMUSG00000038564
Gene Name intraflagellar transport 172
Synonyms wim
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 31253277-31291116 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31257900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1322 (S1322P)
Ref Sequence ENSEMBL: ENSMUSP00000049335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041565] [ENSMUST00000054829] [ENSMUST00000201625] [ENSMUST00000201937]
AlphaFold Q6VH22
Predicted Effect possibly damaging
Transcript: ENSMUST00000041565
AA Change: S1322P

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: S1322P

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000054829
SMART Domains Protein: ENSMUSP00000060414
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 211 8.6e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201565
Predicted Effect probably benign
Transcript: ENSMUST00000201625
SMART Domains Protein: ENSMUSP00000144052
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201672
Predicted Effect probably benign
Transcript: ENSMUST00000201937
SMART Domains Protein: ENSMUSP00000144464
Gene: ENSMUSG00000029149

DomainStartEndE-ValueType
Pfam:BCLP 19 206 1.8e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202560
Meta Mutation Damage Score 0.1032 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Ift172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ift172 APN 5 31275896 missense probably damaging 1.00
IGL01399:Ift172 APN 5 31266248 missense probably benign
IGL01405:Ift172 APN 5 31261852 nonsense probably null
IGL01562:Ift172 APN 5 31267247 missense probably damaging 0.97
IGL01758:Ift172 APN 5 31280714 missense probably benign
IGL01792:Ift172 APN 5 31276871 missense probably damaging 1.00
IGL01830:Ift172 APN 5 31285292 missense probably damaging 1.00
IGL01839:Ift172 APN 5 31266350 missense probably damaging 1.00
IGL02007:Ift172 APN 5 31286604 missense probably benign 0.17
IGL02172:Ift172 APN 5 31281337 splice site probably benign
IGL02190:Ift172 APN 5 31254458 missense possibly damaging 0.51
IGL02334:Ift172 APN 5 31283058 missense probably benign 0.00
IGL02486:Ift172 APN 5 31257583 missense probably damaging 1.00
IGL02517:Ift172 APN 5 31253648 splice site probably null
IGL02571:Ift172 APN 5 31257891 missense probably damaging 1.00
IGL02626:Ift172 APN 5 31264496 missense probably benign
IGL03183:Ift172 APN 5 31272004 missense probably benign 0.06
IGL03277:Ift172 APN 5 31267298 missense possibly damaging 0.92
IGL03349:Ift172 APN 5 31284130 missense probably benign 0.05
ostinato UTSW 5 31276940 missense probably benign 0.10
pushback UTSW 5 31286945 missense probably damaging 1.00
P0042:Ift172 UTSW 5 31261455 missense probably benign 0.35
PIT4802001:Ift172 UTSW 5 31285266 missense probably benign 0.03
R0153:Ift172 UTSW 5 31260624 missense probably benign
R0328:Ift172 UTSW 5 31263851 nonsense probably null
R0369:Ift172 UTSW 5 31253641 missense probably damaging 1.00
R0391:Ift172 UTSW 5 31286667 missense probably damaging 1.00
R0512:Ift172 UTSW 5 31285477 missense possibly damaging 0.92
R0546:Ift172 UTSW 5 31257601 missense probably benign 0.14
R0553:Ift172 UTSW 5 31275842 splice site probably benign
R0606:Ift172 UTSW 5 31254313 missense probably damaging 0.99
R0834:Ift172 UTSW 5 31257371 missense probably benign
R0973:Ift172 UTSW 5 31265355 missense probably benign
R0973:Ift172 UTSW 5 31257918 unclassified probably benign
R1189:Ift172 UTSW 5 31285830 critical splice acceptor site probably null
R1205:Ift172 UTSW 5 31285792 missense probably benign
R1289:Ift172 UTSW 5 31280976 missense probably damaging 0.98
R1342:Ift172 UTSW 5 31261866 missense probably benign
R1395:Ift172 UTSW 5 31285238 unclassified probably benign
R1417:Ift172 UTSW 5 31256649 missense probably damaging 1.00
R2020:Ift172 UTSW 5 31267241 nonsense probably null
R2111:Ift172 UTSW 5 31286079 missense probably benign 0.04
R2175:Ift172 UTSW 5 31266685 missense probably damaging 1.00
R2509:Ift172 UTSW 5 31262968 missense probably benign
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R3705:Ift172 UTSW 5 31261437 critical splice donor site probably null
R3793:Ift172 UTSW 5 31257581 missense possibly damaging 0.61
R4385:Ift172 UTSW 5 31286967 missense probably damaging 1.00
R4477:Ift172 UTSW 5 31265437 missense probably benign 0.38
R4590:Ift172 UTSW 5 31253955 missense probably damaging 1.00
R4663:Ift172 UTSW 5 31284215 missense probably benign 0.01
R4665:Ift172 UTSW 5 31285254 missense possibly damaging 0.82
R4977:Ift172 UTSW 5 31272116 missense possibly damaging 0.79
R5109:Ift172 UTSW 5 31265986 missense probably benign 0.06
R5182:Ift172 UTSW 5 31267614 missense possibly damaging 0.51
R5343:Ift172 UTSW 5 31263812 missense probably benign 0.05
R5465:Ift172 UTSW 5 31261518 splice site probably null
R5622:Ift172 UTSW 5 31283082 missense probably damaging 1.00
R5718:Ift172 UTSW 5 31255277 missense possibly damaging 0.94
R5793:Ift172 UTSW 5 31276948 missense possibly damaging 0.96
R5870:Ift172 UTSW 5 31276940 missense probably benign 0.10
R5919:Ift172 UTSW 5 31260662 missense possibly damaging 0.63
R5968:Ift172 UTSW 5 31261484 missense probably damaging 1.00
R6112:Ift172 UTSW 5 31256897 missense probably benign
R6339:Ift172 UTSW 5 31256583 missense probably benign 0.00
R6339:Ift172 UTSW 5 31286945 missense probably damaging 1.00
R6355:Ift172 UTSW 5 31284157 missense probably benign 0.33
R6565:Ift172 UTSW 5 31275883 missense possibly damaging 0.68
R6668:Ift172 UTSW 5 31255339 missense probably benign 0.00
R6755:Ift172 UTSW 5 31260998 nonsense probably null
R6818:Ift172 UTSW 5 31265960 missense probably benign 0.01
R6939:Ift172 UTSW 5 31257586 missense probably damaging 1.00
R6980:Ift172 UTSW 5 31257386 missense probably benign
R7047:Ift172 UTSW 5 31275894 nonsense probably null
R7156:Ift172 UTSW 5 31272075 missense probably damaging 1.00
R7180:Ift172 UTSW 5 31254262 missense probably damaging 1.00
R7288:Ift172 UTSW 5 31285286 missense probably damaging 1.00
R7351:Ift172 UTSW 5 31275896 missense probably damaging 1.00
R7706:Ift172 UTSW 5 31266379 nonsense probably null
R7890:Ift172 UTSW 5 31283081 nonsense probably null
R7980:Ift172 UTSW 5 31260644 missense probably benign
R8263:Ift172 UTSW 5 31265337 missense possibly damaging 0.48
R8559:Ift172 UTSW 5 31256577 missense probably damaging 0.98
R8717:Ift172 UTSW 5 31255641 missense probably benign 0.00
R8774:Ift172 UTSW 5 31257863 missense probably benign 0.45
R8774-TAIL:Ift172 UTSW 5 31257863 missense probably benign 0.45
R9037:Ift172 UTSW 5 31263056 missense possibly damaging 0.56
R9038:Ift172 UTSW 5 31284055 missense possibly damaging 0.53
R9133:Ift172 UTSW 5 31285523 missense probably benign 0.00
R9607:Ift172 UTSW 5 31253569 missense
X0022:Ift172 UTSW 5 31285320 missense probably damaging 0.97
Z1176:Ift172 UTSW 5 31276924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCATGTGACGCAGTGGTCTTC -3'
(R):5'- AATGCAGTGACCTCAGACAGCCAG -3'

Sequencing Primer
(F):5'- ACTTGGTGAACTCCCACCC -3'
(R):5'- GCATCTGAAGAGCTGTTAGCC -3'
Posted On 2013-04-24