Incidental Mutation 'R0357:Zfp110'
ID29879
Institutional Source Beutler Lab
Gene Symbol Zfp110
Ensembl Gene ENSMUSG00000058638
Gene Namezinc finger protein 110
SynonymsNrif1, NRIF, 2900024E01Rik
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R0357 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12834761-12850577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12836375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 43 (Y43C)
Ref Sequence ENSEMBL: ENSMUSP00000132060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004614] [ENSMUST00000168247]
Predicted Effect probably damaging
Transcript: ENSMUST00000004614
AA Change: Y43C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004614
Gene: ENSMUSG00000058638
AA Change: Y43C

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154011
Predicted Effect probably damaging
Transcript: ENSMUST00000168247
AA Change: Y43C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132060
Gene: ENSMUSG00000058638
AA Change: Y43C

DomainStartEndE-ValueType
KRAB 18 78 1.38e-26 SMART
SCAN 158 269 1.48e-39 SMART
KRAB 284 351 2.94e-12 SMART
low complexity region 424 438 N/A INTRINSIC
ZnF_C2H2 688 710 1.43e-1 SMART
ZnF_C2H2 716 738 2.24e-3 SMART
ZnF_C2H2 744 766 2.27e-4 SMART
ZnF_C2H2 772 794 6.32e-3 SMART
ZnF_C2H2 800 822 2.75e-3 SMART
Meta Mutation Damage Score 0.7088 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Homozygous mutants on a C57BL/6 background die at embryonic day 12. On a strain 129 background, mutants are viable and fertile, but males are more docile and testis weight is greatly reduced. On an F2 background, 20% of homozygous pups die neonatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Zfp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Zfp110 APN 7 12849159 missense probably benign 0.38
IGL01094:Zfp110 APN 7 12849796 missense probably damaging 1.00
IGL01576:Zfp110 APN 7 12849671 missense probably damaging 1.00
IGL01859:Zfp110 APN 7 12849540 missense possibly damaging 0.86
IGL02003:Zfp110 APN 7 12849905 nonsense probably null
R0122:Zfp110 UTSW 7 12848597 missense possibly damaging 0.51
R0383:Zfp110 UTSW 7 12849260 missense probably benign 0.00
R0725:Zfp110 UTSW 7 12836363 missense possibly damaging 0.52
R0926:Zfp110 UTSW 7 12849881 nonsense probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1146:Zfp110 UTSW 7 12846794 critical splice acceptor site probably null
R1472:Zfp110 UTSW 7 12848541 missense possibly damaging 0.85
R1663:Zfp110 UTSW 7 12848642 missense probably benign 0.08
R1975:Zfp110 UTSW 7 12848502 missense probably benign 0.00
R2046:Zfp110 UTSW 7 12849422 missense probably benign 0.00
R2296:Zfp110 UTSW 7 12849540 missense probably damaging 0.97
R2341:Zfp110 UTSW 7 12849186 missense probably benign 0.04
R4332:Zfp110 UTSW 7 12844571 nonsense probably null
R5892:Zfp110 UTSW 7 12848478 missense probably benign 0.00
R5955:Zfp110 UTSW 7 12848745 missense possibly damaging 0.85
R6083:Zfp110 UTSW 7 12844675 missense possibly damaging 0.95
R6115:Zfp110 UTSW 7 12849774 missense probably damaging 0.98
R7187:Zfp110 UTSW 7 12849826 nonsense probably null
R7455:Zfp110 UTSW 7 12848057 missense probably benign
R7570:Zfp110 UTSW 7 12849340 missense possibly damaging 0.94
R7727:Zfp110 UTSW 7 12848995 missense possibly damaging 0.91
R7895:Zfp110 UTSW 7 12837093 missense possibly damaging 0.86
R7978:Zfp110 UTSW 7 12837093 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTGTCAGACCGATTTGCTCAAGG -3'
(R):5'- GAGCCCAAGCACTTACAGTTCAGG -3'

Sequencing Primer
(F):5'- CCGATTTGCTCAAGGATTCAGAC -3'
(R):5'- CGCACATCCAGAATTGGGG -3'
Posted On2013-04-24