Incidental Mutation 'R0357:4932431P20Rik'
ID 29880
Institutional Source Beutler Lab
Gene Symbol 4932431P20Rik
Ensembl Gene ENSMUSG00000074224
Gene Name RIKEN cDNA 4932431P20 gene
Synonyms
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 29519205-29538057 bp(+) (GRCm38)
Type of Mutation exon
DNA Base Change (assembly) A to T at 29535582 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098602
SMART Domains Protein: ENSMUSP00000096202
Gene: ENSMUSG00000074224

DomainStartEndE-ValueType
low complexity region 233 239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141713
SMART Domains Protein: ENSMUSP00000120285
Gene: ENSMUSG00000074224

DomainStartEndE-ValueType
Blast:WD40 94 134 1e-9 BLAST
WD40 139 176 1.59e1 SMART
WD40 228 269 9.51e1 SMART
WD40 272 311 3.33e-1 SMART
Blast:WD40 354 393 4e-15 BLAST
Blast:WD40 445 490 2e-22 BLAST
Blast:WD40 493 538 8e-15 BLAST
WD40 595 634 1.68e-6 SMART
low complexity region 701 710 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
coiled coil region 1135 1168 N/A INTRINSIC
low complexity region 1211 1230 N/A INTRINSIC
low complexity region 1239 1273 N/A INTRINSIC
coiled coil region 1347 1375 N/A INTRINSIC
coiled coil region 1399 1433 N/A INTRINSIC
low complexity region 1435 1453 N/A INTRINSIC
low complexity region 1497 1519 N/A INTRINSIC
coiled coil region 1612 1707 N/A INTRINSIC
coiled coil region 1731 1989 N/A INTRINSIC
coiled coil region 2034 2072 N/A INTRINSIC
coiled coil region 2127 2154 N/A INTRINSIC
coiled coil region 2220 2302 N/A INTRINSIC
coiled coil region 2357 2561 N/A INTRINSIC
low complexity region 2993 2999 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in 4932431P20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:4932431P20Rik APN 7 29537622 exon noncoding transcript
IGL00505:4932431P20Rik APN 7 29534183 exon noncoding transcript
IGL00557:4932431P20Rik APN 7 29535802 exon noncoding transcript
IGL00569:4932431P20Rik APN 7 29534140 exon noncoding transcript
IGL00966:4932431P20Rik APN 7 29537463 exon noncoding transcript
IGL01668:4932431P20Rik APN 7 29537430 exon noncoding transcript
K7371:4932431P20Rik UTSW 7 29530992 exon noncoding transcript
P0037:4932431P20Rik UTSW 7 29533614 exon noncoding transcript
R0179:4932431P20Rik UTSW 7 29535940 exon noncoding transcript
R0358:4932431P20Rik UTSW 7 29532211 exon noncoding transcript
R0412:4932431P20Rik UTSW 7 29530570 exon noncoding transcript
R0530:4932431P20Rik UTSW 7 29530120 exon noncoding transcript
R0600:4932431P20Rik UTSW 7 29533265 exon noncoding transcript
R0675:4932431P20Rik UTSW 7 29532517 exon noncoding transcript
R1118:4932431P20Rik UTSW 7 29534244 exon noncoding transcript
R1395:4932431P20Rik UTSW 7 29531387 exon noncoding transcript
R1444:4932431P20Rik UTSW 7 29529955 exon noncoding transcript
R1476:4932431P20Rik UTSW 7 29534890 exon noncoding transcript
R1534:4932431P20Rik UTSW 7 29530429 exon noncoding transcript
R1535:4932431P20Rik UTSW 7 29529579 exon noncoding transcript
R2023:4932431P20Rik UTSW 7 29531534 exon noncoding transcript
R2127:4932431P20Rik UTSW 7 29537140 exon noncoding transcript
R2141:4932431P20Rik UTSW 7 29531510 exon noncoding transcript
R2198:4932431P20Rik UTSW 7 29527272 exon noncoding transcript
R2201:4932431P20Rik UTSW 7 29536525 exon noncoding transcript
R2262:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R2263:4932431P20Rik UTSW 7 29532562 exon noncoding transcript
R4874:4932431P20Rik UTSW 7 29536183 exon noncoding transcript
R5064:4932431P20Rik UTSW 7 29535655 exon noncoding transcript
R5130:4932431P20Rik UTSW 7 29529274 exon noncoding transcript
R5366:4932431P20Rik UTSW 7 29533539 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GGCAAATGAGAAGGCTGAGCACT -3'
(R):5'- cctctttttcttcctcctcttcATGCAC -3'

Sequencing Primer
(F):5'- gaggaggaggtggaagagg -3'
(R):5'- ttcctcctcctcctcttcc -3'
Posted On 2013-04-24