Incidental Mutation 'R0357:Cd163l1'
ID 29883
Institutional Source Beutler Lab
Gene Symbol Cd163l1
Ensembl Gene ENSMUSG00000025461
Gene Name CD163 molecule-like 1
Synonyms E430002D04Rik, Scart1
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140218267-140231145 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 140227895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 660 (C660G)
Ref Sequence ENSEMBL: ENSMUSP00000147699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084460] [ENSMUST00000209398] [ENSMUST00000209637]
AlphaFold A0A1B0GSB0
Predicted Effect probably damaging
Transcript: ENSMUST00000084460
AA Change: C660G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081497
Gene: ENSMUSG00000025461
AA Change: C660G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SR 32 132 1.45e-30 SMART
SR 139 230 4.28e-6 SMART
SR 235 333 2.76e-36 SMART
SR 335 435 1.32e-33 SMART
SR 441 541 5.01e-25 SMART
SR 546 646 7.16e-53 SMART
SR 651 752 3.44e-14 SMART
SR 780 880 8.96e-45 SMART
low complexity region 882 898 N/A INTRINSIC
transmembrane domain 907 929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209376
Predicted Effect probably damaging
Transcript: ENSMUST00000209398
AA Change: C660G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000209637
AA Change: C660G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211540
Meta Mutation Damage Score 0.3241 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Cd163l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cd163l1 APN 7 140224639 critical splice donor site probably null
IGL01921:Cd163l1 APN 7 140228719 nonsense probably null
IGL02168:Cd163l1 APN 7 140223486 missense probably benign 0.02
IGL02306:Cd163l1 APN 7 140223356 missense probably damaging 1.00
IGL02323:Cd163l1 APN 7 140228659 missense probably benign 0.10
IGL02457:Cd163l1 APN 7 140220395 missense probably benign 0.07
IGL02543:Cd163l1 APN 7 140220578 missense probably benign 0.00
IGL02831:Cd163l1 APN 7 140228521 missense probably benign 0.14
IGL03289:Cd163l1 APN 7 140229060 critical splice donor site probably null
lop UTSW 7 140224463 missense possibly damaging 0.91
R0513:Cd163l1 UTSW 7 140224960 nonsense probably null
R1023:Cd163l1 UTSW 7 140224463 missense possibly damaging 0.91
R1519:Cd163l1 UTSW 7 140228156 missense probably benign 0.07
R1711:Cd163l1 UTSW 7 140220609 missense probably damaging 1.00
R2327:Cd163l1 UTSW 7 140223977 missense possibly damaging 0.48
R4957:Cd163l1 UTSW 7 140228522 missense probably damaging 0.99
R5421:Cd163l1 UTSW 7 140223900 missense probably damaging 1.00
R5422:Cd163l1 UTSW 7 140224155 missense probably benign 0.03
R5851:Cd163l1 UTSW 7 140228027 missense possibly damaging 0.93
R5906:Cd163l1 UTSW 7 140228799 missense probably damaging 1.00
R5930:Cd163l1 UTSW 7 140230446 missense probably benign 0.32
R6376:Cd163l1 UTSW 7 140228729 missense probably damaging 1.00
R7380:Cd163l1 UTSW 7 140224877 missense possibly damaging 0.47
R7389:Cd163l1 UTSW 7 140228791 missense possibly damaging 0.95
R7466:Cd163l1 UTSW 7 140220706 critical splice donor site probably null
R7686:Cd163l1 UTSW 7 140222203 nonsense probably null
R7722:Cd163l1 UTSW 7 140222386 nonsense probably null
R8535:Cd163l1 UTSW 7 140224721 missense probably benign 0.06
R8900:Cd163l1 UTSW 7 140228565 nonsense probably null
R9041:Cd163l1 UTSW 7 140228590 missense probably damaging 1.00
R9116:Cd163l1 UTSW 7 140228364 missense probably benign
R9319:Cd163l1 UTSW 7 140228027 missense possibly damaging 0.93
Z1176:Cd163l1 UTSW 7 140224857 missense probably benign 0.17
Z1186:Cd163l1 UTSW 7 140224490 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGTGCAAGTGATGCCAGGGTATAAC -3'
(R):5'- TCCAGCCATGAAGTTCAGTGGCAG -3'

Sequencing Primer
(F):5'- ACTGGGTCAAATGGCATTATCTG -3'
(R):5'- AGAAACTTTTACTGGGGTCCACC -3'
Posted On 2013-04-24