Incidental Mutation 'R0357:Col5a3'
ID 29887
Institutional Source Beutler Lab
Gene Symbol Col5a3
Ensembl Gene ENSMUSG00000004098
Gene Name collagen, type V, alpha 3
Synonyms Pro-alpha3(V)
MMRRC Submission 038563-MU
Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 20770050-20815067 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 20807768 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004201]
AlphaFold Q9JLI2
Predicted Effect probably benign
Transcript: ENSMUST00000004201
SMART Domains Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSPN 32 211 7.08e-28 SMART
LamG 89 210 2.13e-2 SMART
low complexity region 247 267 N/A INTRINSIC
low complexity region 295 314 N/A INTRINSIC
low complexity region 341 347 N/A INTRINSIC
low complexity region 369 381 N/A INTRINSIC
low complexity region 391 434 N/A INTRINSIC
low complexity region 461 474 N/A INTRINSIC
Pfam:Collagen 475 538 5.5e-10 PFAM
low complexity region 597 616 N/A INTRINSIC
low complexity region 628 694 N/A INTRINSIC
internal_repeat_3 703 737 7.13e-16 PROSPERO
low complexity region 742 821 N/A INTRINSIC
low complexity region 823 844 N/A INTRINSIC
low complexity region 859 889 N/A INTRINSIC
internal_repeat_2 892 1081 5.05e-17 PROSPERO
internal_repeat_1 996 1133 7.47e-22 PROSPERO
internal_repeat_3 1105 1139 7.13e-16 PROSPERO
low complexity region 1140 1165 N/A INTRINSIC
low complexity region 1168 1255 N/A INTRINSIC
low complexity region 1258 1282 N/A INTRINSIC
low complexity region 1285 1306 N/A INTRINSIC
low complexity region 1311 1418 N/A INTRINSIC
Pfam:Collagen 1429 1491 9.5e-10 PFAM
COLFI 1508 1738 7.98e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157103
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Col5a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col5a3 APN 9 20786389 nonsense probably null
IGL01548:Col5a3 APN 9 20803000 splice site probably benign
IGL02164:Col5a3 APN 9 20792643 critical splice donor site probably null
IGL02297:Col5a3 APN 9 20772154 missense unknown
IGL02333:Col5a3 APN 9 20799306 missense unknown
IGL02349:Col5a3 APN 9 20772361 missense unknown
IGL02390:Col5a3 APN 9 20776996 missense unknown
IGL02685:Col5a3 APN 9 20772205 missense unknown
IGL02941:Col5a3 APN 9 20804666 missense unknown
IGL03001:Col5a3 APN 9 20807744 missense unknown
IGL03061:Col5a3 APN 9 20797572 critical splice donor site probably null
IGL03102:Col5a3 APN 9 20804635 critical splice donor site probably null
IGL03308:Col5a3 APN 9 20808379 missense unknown
IGL03372:Col5a3 APN 9 20775328 missense unknown
Guppy UTSW 9 20779033 missense probably damaging 1.00
minifish UTSW 9 20785586 missense probably damaging 0.99
R0002:Col5a3 UTSW 9 20809856 critical splice acceptor site probably null
R0012:Col5a3 UTSW 9 20777108 splice site probably benign
R0316:Col5a3 UTSW 9 20775325 missense unknown
R0360:Col5a3 UTSW 9 20772466 missense unknown
R0483:Col5a3 UTSW 9 20782481 splice site probably null
R0485:Col5a3 UTSW 9 20782708 missense probably damaging 0.99
R0627:Col5a3 UTSW 9 20775485 missense unknown
R1035:Col5a3 UTSW 9 20793499 splice site probably benign
R1051:Col5a3 UTSW 9 20775235 missense unknown
R1295:Col5a3 UTSW 9 20808418 missense unknown
R1438:Col5a3 UTSW 9 20779957 missense probably damaging 0.99
R1622:Col5a3 UTSW 9 20772220 missense unknown
R1668:Col5a3 UTSW 9 20771096 missense unknown
R1680:Col5a3 UTSW 9 20784668 critical splice donor site probably null
R2112:Col5a3 UTSW 9 20809777 missense unknown
R2149:Col5a3 UTSW 9 20771270 missense unknown
R2159:Col5a3 UTSW 9 20771310 missense unknown
R2939:Col5a3 UTSW 9 20795658 missense unknown
R3236:Col5a3 UTSW 9 20807653 missense unknown
R3845:Col5a3 UTSW 9 20808377 missense unknown
R4598:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4599:Col5a3 UTSW 9 20774559 critical splice donor site probably null
R4611:Col5a3 UTSW 9 20814896 unclassified probably benign
R4713:Col5a3 UTSW 9 20793574 missense unknown
R4723:Col5a3 UTSW 9 20809591 missense unknown
R5209:Col5a3 UTSW 9 20778643 intron probably benign
R5336:Col5a3 UTSW 9 20799301 missense unknown
R5378:Col5a3 UTSW 9 20797576 missense unknown
R5614:Col5a3 UTSW 9 20783476 splice site probably benign
R5775:Col5a3 UTSW 9 20801072 missense unknown
R5895:Col5a3 UTSW 9 20772442 missense unknown
R6048:Col5a3 UTSW 9 20807619 missense unknown
R6265:Col5a3 UTSW 9 20793764 missense unknown
R6372:Col5a3 UTSW 9 20785586 missense probably damaging 0.99
R6520:Col5a3 UTSW 9 20774052 missense unknown
R6558:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6608:Col5a3 UTSW 9 20774019 missense unknown
R6679:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6680:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6696:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6698:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6700:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6708:Col5a3 UTSW 9 20775035 missense unknown
R6712:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6714:Col5a3 UTSW 9 20779033 missense probably damaging 1.00
R6828:Col5a3 UTSW 9 20798452 missense unknown
R7343:Col5a3 UTSW 9 20793946 critical splice donor site probably null
R7431:Col5a3 UTSW 9 20770835 makesense probably null
R7500:Col5a3 UTSW 9 20800289 missense unknown
R7592:Col5a3 UTSW 9 20797393 missense unknown
R7671:Col5a3 UTSW 9 20775086 critical splice acceptor site probably null
R7957:Col5a3 UTSW 9 20774051 missense unknown
R8510:Col5a3 UTSW 9 20793732 missense unknown
R8979:Col5a3 UTSW 9 20775301 missense unknown
R9050:Col5a3 UTSW 9 20786395 missense probably damaging 1.00
R9052:Col5a3 UTSW 9 20799437 missense unknown
R9072:Col5a3 UTSW 9 20771157 missense unknown
R9341:Col5a3 UTSW 9 20793613 missense unknown
R9343:Col5a3 UTSW 9 20793613 missense unknown
R9529:Col5a3 UTSW 9 20774012 critical splice donor site probably null
R9562:Col5a3 UTSW 9 20803133 missense unknown
R9781:Col5a3 UTSW 9 20809976 missense unknown
Z1177:Col5a3 UTSW 9 20775334 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTTACCTGGTTCTCAGGGGCAC -3'
(R):5'- GACTGGAAACTCAGGGCAGATCAC -3'

Sequencing Primer
(F):5'- TTCTCAGGGGCACCAGGG -3'
(R):5'- gcacatctcagtcccctc -3'
Posted On 2013-04-24