Incidental Mutation 'R0357:Olfr1392'
ID 29892
Institutional Source Beutler Lab
Gene Symbol Olfr1392
Ensembl Gene ENSMUSG00000101750
Gene Name olfactory receptor 1392
Synonyms MOR256-25, GA_x6K02T2QP88-6141322-6140387
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 49285282-49295891 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 49293786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 155 (N155S)
Ref Sequence ENSEMBL: ENSMUSP00000149746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189851] [ENSMUST00000214170] [ENSMUST00000214598] [ENSMUST00000215861] [ENSMUST00000217275]
AlphaFold Q8VFA6
Predicted Effect probably damaging
Transcript: ENSMUST00000054866
AA Change: N155S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060333
Gene: ENSMUSG00000050959
AA Change: N155S

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 4.9e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 222 7.1e-8 PFAM
Pfam:7tm_1 41 289 2.5e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189851
AA Change: N155S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140904
Gene: ENSMUSG00000101750
AA Change: N155S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 222 7.1e-8 PFAM
Pfam:7tm_1 41 289 2.4e-32 PFAM
Pfam:7tm_4 139 282 1.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213684
Predicted Effect probably damaging
Transcript: ENSMUST00000214170
AA Change: N155S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214516
Predicted Effect probably damaging
Transcript: ENSMUST00000214598
AA Change: N155S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000215861
AA Change: N155S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217275
AA Change: N155S

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.3169 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Olfr1392
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr1392 APN 11 49293630 missense possibly damaging 0.55
IGL02530:Olfr1392 APN 11 49293728 missense possibly damaging 0.78
IGL03026:Olfr1392 APN 11 49293458 missense probably damaging 0.99
IGL03106:Olfr1392 APN 11 49294161 missense probably damaging 0.99
R0396:Olfr1392 UTSW 11 49293338 missense probably benign 0.00
R2281:Olfr1392 UTSW 11 49293632 missense probably benign 0.04
R4319:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4320:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4322:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R4323:Olfr1392 UTSW 11 49293676 missense probably damaging 1.00
R5327:Olfr1392 UTSW 11 49293666 missense probably damaging 1.00
R6749:Olfr1392 UTSW 11 49294050 missense probably damaging 1.00
R7779:Olfr1392 UTSW 11 49294221 missense probably damaging 1.00
R8122:Olfr1392 UTSW 11 49293574 missense probably damaging 0.99
R8356:Olfr1392 UTSW 11 49293558 missense probably damaging 1.00
R8456:Olfr1392 UTSW 11 49293558 missense probably damaging 1.00
R8737:Olfr1392 UTSW 11 49294138 missense probably damaging 1.00
R8746:Olfr1392 UTSW 11 49293166 intron probably benign
R9375:Olfr1392 UTSW 11 49294075 nonsense probably null
X0012:Olfr1392 UTSW 11 49293933 missense probably benign 0.36
X0025:Olfr1392 UTSW 11 49293953 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCGAATGGACCTTCAACTGCAC -3'
(R):5'- TGGCAGGCACTGCAACAATCAC -3'

Sequencing Primer
(F):5'- CAGGACCATCAGCTATGGAG -3'
(R):5'- TGCAACAATCACTGCTCTGG -3'
Posted On 2013-04-24