Incidental Mutation 'R0357:Shroom1'
ID 29893
Institutional Source Beutler Lab
Gene Symbol Shroom1
Ensembl Gene ENSMUSG00000018387
Gene Name shroom family member 1
Synonyms Shrm1, Apx, 1300007L22Rik
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 53457205-53467766 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 53465208 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 362 (T362A)
Ref Sequence ENSEMBL: ENSMUSP00000104641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018531] [ENSMUST00000057722] [ENSMUST00000093114] [ENSMUST00000109013]
AlphaFold Q5SX79
Predicted Effect probably benign
Transcript: ENSMUST00000018531
SMART Domains Protein: ENSMUSP00000018531
Gene: ENSMUSG00000018387

DomainStartEndE-ValueType
Pfam:ASD1 108 269 1.1e-21 PFAM
low complexity region 410 417 N/A INTRINSIC
Pfam:ASD2 454 732 4.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057722
Predicted Effect possibly damaging
Transcript: ENSMUST00000093114
AA Change: T362A

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090802
Gene: ENSMUSG00000018387
AA Change: T362A

DomainStartEndE-ValueType
Pfam:ASD1 108 269 3.7e-22 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 517 715 1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109010
Predicted Effect probably damaging
Transcript: ENSMUST00000109013
AA Change: T362A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104641
Gene: ENSMUSG00000018387
AA Change: T362A

DomainStartEndE-ValueType
Pfam:ASD1 114 269 4.2e-19 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 518 795 2.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155297
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Shroom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Shroom1 APN 11 53464094 missense probably benign 0.00
IGL00985:Shroom1 APN 11 53465969 missense probably benign
IGL01111:Shroom1 APN 11 53464048 missense probably damaging 0.98
IGL01316:Shroom1 APN 11 53465558 missense probably damaging 0.99
IGL02512:Shroom1 APN 11 53466559 missense probably damaging 1.00
IGL03062:Shroom1 APN 11 53463379 missense probably benign
bracket UTSW 11 53463982 nonsense probably null
shitake UTSW 11 53465722 missense possibly damaging 0.91
R0083:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0661:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R1875:Shroom1 UTSW 11 53465675 missense probably damaging 0.99
R2356:Shroom1 UTSW 11 53466447 missense probably benign 0.05
R4657:Shroom1 UTSW 11 53465588 missense possibly damaging 0.79
R4662:Shroom1 UTSW 11 53466462 missense possibly damaging 0.64
R4690:Shroom1 UTSW 11 53465722 missense possibly damaging 0.91
R4734:Shroom1 UTSW 11 53465233 missense probably damaging 1.00
R4820:Shroom1 UTSW 11 53465139 missense probably benign 0.07
R4964:Shroom1 UTSW 11 53465172 missense probably benign
R5000:Shroom1 UTSW 11 53467117 utr 3 prime probably benign
R5046:Shroom1 UTSW 11 53464045 missense probably benign 0.00
R5141:Shroom1 UTSW 11 53463982 nonsense probably null
R5256:Shroom1 UTSW 11 53465507 missense probably benign 0.32
R5273:Shroom1 UTSW 11 53463844 missense possibly damaging 0.82
R5529:Shroom1 UTSW 11 53463922 missense probably damaging 1.00
R5762:Shroom1 UTSW 11 53463991 missense probably benign 0.00
R6058:Shroom1 UTSW 11 53463481 missense possibly damaging 0.83
R6408:Shroom1 UTSW 11 53463387 missense probably benign 0.00
R6677:Shroom1 UTSW 11 53463516 missense possibly damaging 0.85
R7090:Shroom1 UTSW 11 53465933 missense probably damaging 1.00
R7369:Shroom1 UTSW 11 53465248 missense probably benign 0.43
R7654:Shroom1 UTSW 11 53466908 missense probably benign 0.02
R7919:Shroom1 UTSW 11 53463393 missense probably benign 0.17
R7964:Shroom1 UTSW 11 53464322 missense possibly damaging 0.94
R8338:Shroom1 UTSW 11 53463280 missense probably benign 0.08
R8365:Shroom1 UTSW 11 53465641 nonsense probably null
R8386:Shroom1 UTSW 11 53466403 missense probably damaging 1.00
R8971:Shroom1 UTSW 11 53465167 missense probably damaging 0.99
R9116:Shroom1 UTSW 11 53463663 missense probably damaging 1.00
R9392:Shroom1 UTSW 11 53463847 missense possibly damaging 0.91
R9410:Shroom1 UTSW 11 53463390 missense probably damaging 1.00
R9577:Shroom1 UTSW 11 53466785 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACGTGCCTCAGTCTGAGACTTCC -3'
(R):5'- CAACACCTGGGCATTACCTGAGAG -3'

Sequencing Primer
(F):5'- TCAGTCTGAGACTTCCGACAG -3'
(R):5'- GCATTACCTGAGAGAGTTCCCAG -3'
Posted On 2013-04-24