Incidental Mutation 'R0357:Alox12'
ID 29895
Institutional Source Beutler Lab
Gene Symbol Alox12
Ensembl Gene ENSMUSG00000000320
Gene Name arachidonate 12-lipoxygenase
Synonyms P-12LO, 9930022G08Rik, Alox12p
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70241457-70255353 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70242536 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 614 (Y614C)
Ref Sequence ENSEMBL: ENSMUSP00000000329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000329] [ENSMUST00000021180] [ENSMUST00000021181] [ENSMUST00000040428] [ENSMUST00000100950] [ENSMUST00000102569] [ENSMUST00000108575] [ENSMUST00000108576] [ENSMUST00000108577] [ENSMUST00000108578] [ENSMUST00000108579] [ENSMUST00000125752] [ENSMUST00000176268] [ENSMUST00000141880] [ENSMUST00000176116]
AlphaFold P39655
Predicted Effect probably damaging
Transcript: ENSMUST00000000329
AA Change: Y614C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000329
Gene: ENSMUSG00000000320
AA Change: Y614C

DomainStartEndE-ValueType
LH2 2 111 9.78e-40 SMART
Pfam:Lipoxygenase 172 650 5.1e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021180
SMART Domains Protein: ENSMUSP00000021180
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
Blast:SANT 38 69 1e-16 BLAST
SCOP:d1ba5__ 41 59 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021181
SMART Domains Protein: ENSMUSP00000021181
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 135 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040428
SMART Domains Protein: ENSMUSP00000048271
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100950
SMART Domains Protein: ENSMUSP00000098510
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 37 82 7.29e-1 SMART
low complexity region 105 128 N/A INTRINSIC
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102569
SMART Domains Protein: ENSMUSP00000099629
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108575
SMART Domains Protein: ENSMUSP00000104215
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108576
SMART Domains Protein: ENSMUSP00000104216
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108577
SMART Domains Protein: ENSMUSP00000104218
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108578
SMART Domains Protein: ENSMUSP00000104219
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
SANT 38 83 7.29e-1 SMART
low complexity region 106 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108579
SMART Domains Protein: ENSMUSP00000104220
Gene: ENSMUSG00000020831

DomainStartEndE-ValueType
low complexity region 72 95 N/A INTRINSIC
low complexity region 101 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150504
Predicted Effect probably benign
Transcript: ENSMUST00000176268
SMART Domains Protein: ENSMUSP00000135088
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 65 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141880
SMART Domains Protein: ENSMUSP00000135383
Gene: ENSMUSG00000093989

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176116
SMART Domains Protein: ENSMUSP00000135134
Gene: ENSMUSG00000040904

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Meta Mutation Damage Score 0.5130 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased basal transepidermal water loss and hypersensitivity to adenosine 5'-diphosphate-induced platelet aggregation and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Alox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Alox12 APN 11 70254549 missense probably benign 0.12
IGL01629:Alox12 APN 11 70242834 missense probably damaging 1.00
IGL02657:Alox12 APN 11 70247278 missense probably benign
IGL02966:Alox12 APN 11 70250085 missense probably damaging 1.00
R0243:Alox12 UTSW 11 70242716 missense possibly damaging 0.82
R0394:Alox12 UTSW 11 70245935 missense probably damaging 1.00
R0422:Alox12 UTSW 11 70254558 missense probably damaging 1.00
R0564:Alox12 UTSW 11 70252836 missense probably damaging 0.99
R0751:Alox12 UTSW 11 70246950 missense probably benign 0.00
R1539:Alox12 UTSW 11 70253243 splice site probably null
R1562:Alox12 UTSW 11 70250165 missense probably damaging 0.97
R2165:Alox12 UTSW 11 70242572 splice site probably null
R2295:Alox12 UTSW 11 70242465 missense probably benign 0.45
R4073:Alox12 UTSW 11 70247310 missense probably damaging 1.00
R4558:Alox12 UTSW 11 70253063 missense probably benign 0.03
R5081:Alox12 UTSW 11 70255314 splice site probably null
R5198:Alox12 UTSW 11 70254417 missense probably damaging 1.00
R5507:Alox12 UTSW 11 70254412 missense possibly damaging 0.87
R5793:Alox12 UTSW 11 70243053 missense probably benign 0.00
R5832:Alox12 UTSW 11 70253280 missense probably damaging 0.98
R5975:Alox12 UTSW 11 70242783 missense possibly damaging 0.89
R5984:Alox12 UTSW 11 70247055 missense possibly damaging 0.83
R5988:Alox12 UTSW 11 70251587 missense probably benign 0.05
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6030:Alox12 UTSW 11 70254591 missense possibly damaging 0.72
R6248:Alox12 UTSW 11 70253110 missense probably damaging 1.00
R6505:Alox12 UTSW 11 70250204 missense probably damaging 1.00
R7320:Alox12 UTSW 11 70254472 missense probably benign 0.02
R7595:Alox12 UTSW 11 70242404 missense probably damaging 1.00
R7972:Alox12 UTSW 11 70242687 missense probably benign 0.15
R8787:Alox12 UTSW 11 70253320 missense probably benign 0.01
R8845:Alox12 UTSW 11 70247051 missense probably damaging 1.00
R9051:Alox12 UTSW 11 70247327 missense possibly damaging 0.93
R9055:Alox12 UTSW 11 70253077 missense probably damaging 0.99
R9730:Alox12 UTSW 11 70250094 missense probably benign 0.21
R9784:Alox12 UTSW 11 70252839 missense possibly damaging 0.91
X0025:Alox12 UTSW 11 70255224 missense probably damaging 0.96
Z1177:Alox12 UTSW 11 70251479 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGGTGGCCCTCCAAAGACTAAATTG -3'
(R):5'- GCAGCCAGACATGGTGAGTAATGAC -3'

Sequencing Primer
(F):5'- GCAAGACATTTAGTGCCCTG -3'
(R):5'- CATGGTGAGTAATGACCACGG -3'
Posted On 2013-04-24