Incidental Mutation 'R0357:Pum2'
ID 29898
Institutional Source Beutler Lab
Gene Symbol Pum2
Ensembl Gene ENSMUSG00000020594
Gene Name pumilio RNA-binding family member 2
Synonyms 5730503J23Rik, Pumm2
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 8674134-8752581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 8721785 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 371 (Q371R)
Ref Sequence ENSEMBL: ENSMUSP00000020915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020915] [ENSMUST00000111122] [ENSMUST00000111123] [ENSMUST00000163569] [ENSMUST00000165293] [ENSMUST00000168361] [ENSMUST00000169089] [ENSMUST00000178015]
AlphaFold Q80U58
Predicted Effect possibly damaging
Transcript: ENSMUST00000020915
AA Change: Q371R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020915
Gene: ENSMUSG00000020594
AA Change: Q371R

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 319 336 N/A INTRINSIC
low complexity region 353 378 N/A INTRINSIC
low complexity region 464 490 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 542 576 N/A INTRINSIC
low complexity region 591 609 N/A INTRINSIC
Pumilio 642 677 2.35e-7 SMART
Pumilio 678 713 6.54e-6 SMART
Pumilio 714 749 2.89e-7 SMART
Pumilio 750 785 3.37e-8 SMART
Pumilio 786 821 4.84e-9 SMART
Pumilio 822 857 3.2e-9 SMART
Pumilio 858 893 5.78e-7 SMART
Pumilio 901 936 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111122
AA Change: Q376R

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106751
Gene: ENSMUSG00000020594
AA Change: Q376R

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111123
AA Change: Q376R

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106752
Gene: ENSMUSG00000020594
AA Change: Q376R

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 833 2.89e-7 SMART
Pumilio 834 869 3.37e-8 SMART
Pumilio 870 905 4.84e-9 SMART
Pumilio 906 941 3.2e-9 SMART
Pumilio 942 977 5.78e-7 SMART
Pumilio 985 1020 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163569
AA Change: Q376R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131074
Gene: ENSMUSG00000020594
AA Change: Q376R

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165293
Predicted Effect probably benign
Transcript: ENSMUST00000168361
AA Change: Q376R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128292
Gene: ENSMUSG00000020594
AA Change: Q376R

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 602 N/A INTRINSIC
low complexity region 630 660 N/A INTRINSIC
low complexity region 675 693 N/A INTRINSIC
Pumilio 726 761 2.35e-7 SMART
Pumilio 762 797 6.54e-6 SMART
Pumilio 798 832 1.29e-4 SMART
Pumilio 836 871 3.37e-8 SMART
Pumilio 872 907 4.84e-9 SMART
Pumilio 908 943 3.2e-9 SMART
Pumilio 944 979 5.78e-7 SMART
Pumilio 987 1022 3.62e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169089
AA Change: Q376R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000132122
Gene: ENSMUSG00000020594
AA Change: Q376R

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171418
AA Change: Q231R
SMART Domains Protein: ENSMUSP00000126616
Gene: ENSMUSG00000020594
AA Change: Q231R

DomainStartEndE-ValueType
low complexity region 55 68 N/A INTRINSIC
low complexity region 131 152 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
low complexity region 214 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178015
AA Change: Q376R

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137020
Gene: ENSMUSG00000020594
AA Change: Q376R

DomainStartEndE-ValueType
low complexity region 193 206 N/A INTRINSIC
low complexity region 269 290 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 358 383 N/A INTRINSIC
low complexity region 469 495 N/A INTRINSIC
low complexity region 503 514 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 547 581 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
Pumilio 647 682 2.35e-7 SMART
Pumilio 683 718 6.54e-6 SMART
Pumilio 719 754 2.89e-7 SMART
Pumilio 755 790 3.37e-8 SMART
Pumilio 791 826 4.84e-9 SMART
Pumilio 827 862 3.2e-9 SMART
Pumilio 863 898 5.78e-7 SMART
Pumilio 906 941 3.62e-8 SMART
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of RNA-binding proteins. The encoded protein functions as a translational repressor during embryonic development and cell differentiation. This protein is also thought to be a positive regulator of cell proliferation in adipose-derived stem cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit significantly smaller testes and seminiferous tubule degeneration but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Pum2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Pum2 APN 12 8733381 missense probably damaging 1.00
IGL02118:Pum2 APN 12 8729117 missense probably benign 0.31
IGL02185:Pum2 APN 12 8748955 critical splice donor site probably null
IGL02528:Pum2 APN 12 8728696 nonsense probably null
IGL02718:Pum2 APN 12 8733344 missense probably benign 0.02
Plumbat UTSW 12 8728779 critical splice donor site probably null
Pummie UTSW 12 8713906 nonsense probably null
Yorkshire UTSW 12 8728726 nonsense probably null
PIT4366001:Pum2 UTSW 12 8733390 missense probably damaging 1.00
R0152:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0317:Pum2 UTSW 12 8728754 missense possibly damaging 0.94
R0413:Pum2 UTSW 12 8713464 missense probably benign 0.00
R0494:Pum2 UTSW 12 8721736 nonsense probably null
R0520:Pum2 UTSW 12 8721710 missense probably damaging 1.00
R0727:Pum2 UTSW 12 8744465 missense probably damaging 1.00
R1576:Pum2 UTSW 12 8713524 missense probably benign 0.01
R2035:Pum2 UTSW 12 8728638 nonsense probably null
R2060:Pum2 UTSW 12 8728726 nonsense probably null
R2422:Pum2 UTSW 12 8748931 missense possibly damaging 0.70
R2437:Pum2 UTSW 12 8744654 missense probably benign 0.19
R3767:Pum2 UTSW 12 8719076 nonsense probably null
R4715:Pum2 UTSW 12 8747272 missense probably damaging 1.00
R5155:Pum2 UTSW 12 8713572 missense possibly damaging 0.79
R5226:Pum2 UTSW 12 8713458 missense possibly damaging 0.73
R5323:Pum2 UTSW 12 8744706 missense probably damaging 1.00
R6250:Pum2 UTSW 12 8744755 splice site probably null
R6253:Pum2 UTSW 12 8748205 missense probably damaging 1.00
R6508:Pum2 UTSW 12 8748861 missense probably benign 0.17
R6953:Pum2 UTSW 12 8728779 critical splice donor site probably null
R7135:Pum2 UTSW 12 8728952 missense possibly damaging 0.80
R7355:Pum2 UTSW 12 8713906 nonsense probably null
R7586:Pum2 UTSW 12 8747206 missense probably damaging 1.00
R7683:Pum2 UTSW 12 8728922 missense possibly damaging 0.93
R7869:Pum2 UTSW 12 8713595 missense probably benign 0.00
R7873:Pum2 UTSW 12 8748802 missense possibly damaging 0.94
R7980:Pum2 UTSW 12 8713904 missense probably damaging 0.98
R8166:Pum2 UTSW 12 8721739 missense possibly damaging 0.71
R8316:Pum2 UTSW 12 8713456 missense possibly damaging 0.89
R8345:Pum2 UTSW 12 8709454 missense probably damaging 0.99
R8418:Pum2 UTSW 12 8710245 missense possibly damaging 0.87
R8802:Pum2 UTSW 12 8728726 nonsense probably null
R9039:Pum2 UTSW 12 8744430 missense probably damaging 1.00
R9207:Pum2 UTSW 12 8713904 missense probably damaging 0.98
R9366:Pum2 UTSW 12 8733344 missense probably benign 0.02
R9700:Pum2 UTSW 12 8729044 missense probably damaging 0.97
X0039:Pum2 UTSW 12 8728944 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GTCTTTGATAGCAGCAGTAAGCTGGG -3'
(R):5'- CAGGACACACCAAAGCATTGTTTTAGG -3'

Sequencing Primer
(F):5'- agttgtttacaaactgagacgatg -3'
(R):5'- tgtgccactattgccagac -3'
Posted On 2013-04-24