Incidental Mutation 'R0357:Amn'
ID 29899
Institutional Source Beutler Lab
Gene Symbol Amn
Ensembl Gene ENSMUSG00000021278
Gene Name amnionless
Synonyms
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0357 (G1)
Quality Score 205
Status Validated
Chromosome 12
Chromosomal Location 111271095-111276426 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 111274141 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021707]
AlphaFold Q99JB7
Predicted Effect probably null
Transcript: ENSMUST00000021707
SMART Domains Protein: ENSMUSP00000021707
Gene: ENSMUSG00000021278

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Amnionless 21 451 6.4e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220903
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a type I transmembrane protein. The encoded protein is an essential component of the cubulin receptor complex which is thought to play a role in coordinating growth and patterning of the embryo. This protein is thought to modulate a bone morphogenetic protein (BMP) signaling pathway. A homoygous mutation in the mouse gene results in the lack of an amnion in embryos. Mutations in the human gene are associated with Megaloblastic Anemia-1. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic growth arrest between the mid and late streak stages of gastrulation and abnormal ectoderm formation, followed by death. Generation of middle primitive streak derivatives is impaired, leading to absence of mesoderm and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Amn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01479:Amn APN 12 111271793 missense probably damaging 0.97
IGL02397:Amn APN 12 111274479 missense possibly damaging 0.77
IGL02962:Amn APN 12 111274517 missense probably damaging 1.00
IGL02974:Amn APN 12 111271141 missense probably benign 0.01
IGL02837:Amn UTSW 12 111271899 missense possibly damaging 0.74
R1986:Amn UTSW 12 111274997 missense probably damaging 1.00
R1993:Amn UTSW 12 111276092 missense probably damaging 1.00
R2355:Amn UTSW 12 111271812 missense probably damaging 0.99
R3924:Amn UTSW 12 111275680 missense possibly damaging 0.71
R3925:Amn UTSW 12 111275680 missense possibly damaging 0.71
R4364:Amn UTSW 12 111271762 missense probably damaging 0.99
R4687:Amn UTSW 12 111276068 missense probably benign 0.35
R6176:Amn UTSW 12 111274156 missense possibly damaging 0.55
R6209:Amn UTSW 12 111275411 missense probably damaging 0.99
R6300:Amn UTSW 12 111274189 missense probably benign 0.16
R6591:Amn UTSW 12 111275397 missense possibly damaging 0.77
R6691:Amn UTSW 12 111275397 missense possibly damaging 0.77
R8475:Amn UTSW 12 111275385 missense probably benign 0.02
R8747:Amn UTSW 12 111275006 missense probably damaging 1.00
R9262:Amn UTSW 12 111271151 nonsense probably null
X0025:Amn UTSW 12 111275399 missense probably damaging 1.00
Z1088:Amn UTSW 12 111275683 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- GCCTCAGCCACGTTAAGGTTCC -3'
(R):5'- AAAGCAGTCAGGTCCTCGTCGC -3'

Sequencing Primer
(F):5'- AAGGTCGCAGCTTGGGTTTT -3'
(R):5'- ACGCGGAAAGATCCATCG -3'
Posted On 2013-04-24