Mutagenetix > Incidental Mutation

Incidental Mutation 'R0357:Polk'

29902

Institutional Source

Beutler Lab

Gene Symbol

Polk

Ensembl Gene

ENSMUSG00000021668

Gene Name

polymerase (DNA directed), kappa

Synonyms

Dinb1

MMRRC Submission

038563-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R0357 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96480690-96542579 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 96504597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 151 (M151L)

Ref Sequence

ENSEMBL: ENSMUSP00000022172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000091387] [ENSMUST00000220977] [ENSMUST00000221645] [ENSMUST00000221899] [ENSMUST00000222075] [ENSMUST00000222143] [ENSMUST00000222389] [ENSMUST00000223475]

AlphaFold

Q9QUG2

PDB Structure

Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022172
AA Change: M151L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668
AA Change: M151L

Domain	Start	End	E-Value	Type
Pfam:IMS	105	324	1.7e-47	PFAM
Pfam:IMS_C	406	525	5.5e-22	PFAM
PDB:2LSJ\|B	559	582	9e-8	PDB
ZnF_Rad18	619	645	2.89e-9	SMART
ZnF_Rad18	761	787	2.31e-8	SMART
low complexity region	828	839	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000091387
AA Change: M151L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000088950
Gene: ENSMUSG00000021668
AA Change: M151L

Domain	Start	End	E-Value	Type
Pfam:IMS	105	265	1.1e-37	PFAM
Pfam:IMS_C	346	469	8.8e-19	PFAM
PDB:2LSJ\|B	500	523	9e-8	PDB
ZnF_Rad18	560	586	2.89e-9	SMART
ZnF_Rad18	702	728	2.31e-8	SMART
low complexity region	769	780	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220977
AA Change: M151L

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221645
AA Change: M151L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000221899
AA Change: M151L

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

probably damaging
Transcript: ENSMUST00000222075
AA Change: M151L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222143
AA Change: M151L

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000222389
AA Change: M151L

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223475
AA Change: M151L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.6881

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.3%
20x: 89.3%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA polymerase type-Y family of proteins. The encoded protein is a specialized DNA polymerase that catalyzes translesion DNA synthesis, which allows DNA replication in the presence of DNA lesions. Human cell lines lacking a functional copy of this gene exhibit impaired genome integrity and enhanced susceptibility to oxidative damage. Mutations in this gene that impair enzyme activity may be associated with prostate cancer in human patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation of this gene that results in a truncated transcript results in a higher rate of spontaneous germline expanded simple tandem repeat mutations. Homozyogus null mice exhibit normal immunoglobulin gene somatic hypermutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110002H16Rik	T	C	18: 12,179,209	S169P	possibly damaging	Het
4930402H24Rik	A	T	2: 130,712,946		probably benign	Het
4931428F04Rik	A	T	8: 105,285,067	V222E	probably damaging	Het
4932431P20Rik	A	T	7: 29,535,582		noncoding transcript	Het
9230019H11Rik	A	T	10: 3,120,307		noncoding transcript	Het
9230019H11Rik	A	G	10: 3,125,788		noncoding transcript	Het
Abcf2	T	C	5: 24,573,465	K232E	probably benign	Het
AI837181	C	T	19: 5,426,703	T298I	possibly damaging	Het
Alox12	T	C	11: 70,242,536	Y614C	probably damaging	Het
Amn	A	T	12: 111,274,141		probably null	Het
Ankrd33b	A	G	15: 31,305,126	S121P	probably benign	Het
Aox1	A	G	1: 58,092,516	Y1028C	probably damaging	Het
Asph	C	A	4: 9,453,314	R736L	probably benign	Het
Atp2a3	G	A	11: 72,970,931		probably null	Het
Cables2	T	C	2: 180,262,232		probably benign	Het
Catsperg2	A	T	7: 29,714,901	Y360N	possibly damaging	Het
Ccdc129	T	A	6: 55,968,034	M580K	probably benign	Het
Cd163l1	T	G	7: 140,227,895	C660G	probably damaging	Het
Cdh4	T	C	2: 179,847,340	S282P	probably damaging	Het
Col5a3	C	T	9: 20,807,768		probably benign	Het
Ctso	A	T	3: 81,951,543		probably benign	Het
Cyp4f13	A	T	17: 32,932,651	Y125*	probably null	Het
Dapk1	T	A	13: 60,729,558	L537*	probably null	Het
Ddit4l	G	A	3: 137,626,185	R104Q	probably benign	Het
Def6	C	T	17: 28,223,935	H322Y	probably damaging	Het
Dnah6	T	C	6: 73,188,359	N588D	probably benign	Het
Dzip1	T	A	14: 118,909,538	I320F	probably damaging	Het
Epb41l5	T	C	1: 119,609,204	H319R	probably damaging	Het
Erc2	A	G	14: 27,777,022	E285G	probably damaging	Het
Fam109b	C	T	15: 82,343,316	A12V	probably damaging	Het
Fat4	G	A	3: 38,891,227	G1423E	probably damaging	Het
Foxp2	C	T	6: 15,409,840	P480S	probably damaging	Het
Gadd45gip1	G	A	8: 84,834,133	A126T	probably damaging	Het
Gbp5	G	A	3: 142,505,411	D301N	probably benign	Het
Gm10360	T	C	6: 70,424,313		noncoding transcript	Het
Gm6471	T	A	7: 142,833,867		noncoding transcript	Het
Gm8674	T	A	13: 49,902,113		noncoding transcript	Het
Hist2h2bb	A	C	3: 96,269,788	K13Q	probably null	Het
Ift172	A	G	5: 31,257,900	S1322P	possibly damaging	Het
Ift80	A	T	3: 68,914,653	Y686*	probably null	Het
Insrr	A	C	3: 87,808,646		probably null	Het
Krt83	C	T	15: 101,487,019	V399M	probably benign	Het
Macf1	T	C	4: 123,457,983	N3708S	probably damaging	Het
Mogat1	T	C	1: 78,512,040	S27P	probably benign	Het
Mrgpra4	A	T	7: 47,981,826	M9K	probably benign	Het
Mtus1	A	T	8: 41,083,526	S384R	possibly damaging	Het
Myo1a	T	A	10: 127,710,902	M306K	probably benign	Het
Noxa1	G	T	2: 25,085,850	D403E	probably damaging	Het
Ogdhl	T	C	14: 32,346,458	V884A	possibly damaging	Het
Olfr1335	A	C	4: 118,809,417	L149R	probably damaging	Het
Olfr1392	A	G	11: 49,293,786	N155S	probably damaging	Het
Olfr424	T	A	1: 174,137,299	L185*	probably null	Het
Olfr429	T	C	1: 174,089,109	V23A	possibly damaging	Het
Paxip1	G	A	5: 27,758,623		probably benign	Het
Paxx	T	A	2: 25,460,067	E145D	probably damaging	Het
Pde4d	T	C	13: 109,951,268	V560A	possibly damaging	Het
Plxnd1	C	T	6: 115,969,460	V847M	probably benign	Het
Ptprq	C	T	10: 107,686,199		probably benign	Het
Pum2	A	G	12: 8,721,785	Q371R	possibly damaging	Het
Reln	G	A	5: 21,950,822	A2224V	probably damaging	Het
Shroom1	A	G	11: 53,465,208	T362A	probably damaging	Het
Smarcd2	A	G	11: 106,267,332		probably null	Het
Spg11	A	C	2: 122,066,232		probably benign	Het
Tcaf3	T	A	6: 42,589,827	Y776F	probably damaging	Het
Thada	A	G	17: 84,230,936	V1548A	probably damaging	Het
Trpv2	C	T	11: 62,590,304	P410S	probably damaging	Het
Ube2u	G	T	4: 100,481,654	E39*	probably null	Het
Vmn2r2	C	T	3: 64,133,899		probably null	Het
Vmn2r24	TCC	TC	6: 123,815,410		probably null	Het
Zfp110	A	G	7: 12,836,375	Y43C	probably damaging	Het
Zfp605	A	G	5: 110,124,379	T55A	probably benign	Het

Other mutations in Polk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00491:Polk	APN	13	96496760	missense	probably benign	0.25
IGL01803:Polk	APN	13	96504522	missense	probably damaging	1.00
IGL01949:Polk	APN	13	96483538	missense	probably benign	0.10
IGL01986:Polk	APN	13	96483823	missense	probably benign	0.09
IGL02073:Polk	APN	13	96504551	missense	probably damaging	1.00
IGL03165:Polk	APN	13	96516688	missense	probably benign	0.23
IGL03184:Polk	APN	13	96483983	missense	probably benign	0.04
IGL03353:Polk	APN	13	96489211	missense	probably damaging	1.00
R0019:Polk	UTSW	13	96504616	missense	probably damaging	1.00
R0029:Polk	UTSW	13	96516670	missense	probably damaging	1.00
R0200:Polk	UTSW	13	96496822	missense	probably benign	0.11
R0485:Polk	UTSW	13	96483764	missense	probably benign	0.05
R0555:Polk	UTSW	13	96484179	missense	probably damaging	0.97
R0687:Polk	UTSW	13	96484017	missense	probably damaging	1.00
R0980:Polk	UTSW	13	96483764	missense	probably benign	0.05
R1065:Polk	UTSW	13	96508252	missense	probably damaging	1.00
R1396:Polk	UTSW	13	96484208	missense	probably benign	0.02
R1710:Polk	UTSW	13	96489204	missense	probably damaging	1.00
R1770:Polk	UTSW	13	96495442	missense	probably damaging	1.00
R1789:Polk	UTSW	13	96496632	missense	probably damaging	1.00
R1977:Polk	UTSW	13	96489228	missense	probably damaging	1.00
R2301:Polk	UTSW	13	96484144	missense	probably benign	0.09
R3797:Polk	UTSW	13	96486982	splice site	probably benign
R3934:Polk	UTSW	13	96501635	missense	possibly damaging	0.56
R4082:Polk	UTSW	13	96483673	missense	probably benign	0.17
R4307:Polk	UTSW	13	96496666	missense	possibly damaging	0.79
R4472:Polk	UTSW	13	96493905	missense	probably damaging	1.00
R4779:Polk	UTSW	13	96496491	critical splice donor site	probably null
R4795:Polk	UTSW	13	96489256	missense	probably benign	0.01
R4796:Polk	UTSW	13	96489256	missense	probably benign	0.01
R4810:Polk	UTSW	13	96483495	missense	possibly damaging	0.90
R5002:Polk	UTSW	13	96489244	missense	probably damaging	1.00
R5271:Polk	UTSW	13	96483539	missense	probably benign	0.09
R5415:Polk	UTSW	13	96483955	missense	probably benign
R5459:Polk	UTSW	13	96495476	missense	probably damaging	1.00
R5535:Polk	UTSW	13	96495497	missense	probably damaging	1.00
R5619:Polk	UTSW	13	96483556	missense	probably damaging	1.00
R5757:Polk	UTSW	13	96484252	missense	probably benign	0.03
R5801:Polk	UTSW	13	96483586	missense	probably damaging	1.00
R5923:Polk	UTSW	13	96495415	missense	probably damaging	1.00
R6365:Polk	UTSW	13	96484009	missense	probably damaging	1.00
R6670:Polk	UTSW	13	96496630	nonsense	probably null
R6831:Polk	UTSW	13	96495491	missense	possibly damaging	0.87
R6932:Polk	UTSW	13	96516681	missense	probably damaging	1.00
R7216:Polk	UTSW	13	96508220	missense	probably benign	0.32
R7654:Polk	UTSW	13	96496813	missense	probably benign	0.02
R8122:Polk	UTSW	13	96483783	missense	probably benign	0.01
R8222:Polk	UTSW	13	96495515	missense	possibly damaging	0.95
R9024:Polk	UTSW	13	96486832	missense	probably benign	0.00
R9500:Polk	UTSW	13	96493841	missense	probably damaging	0.99
R9789:Polk	UTSW	13	96493895	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATCCTGTACACAGCACCATTC -3'
(R):5'- TCAAGATGTGGTTCAAGACAGTGGC -3'

Sequencing Primer
(F):5'- TCACTATAGGTGAGACCAAACCTTG -3'
(R):5'- CAGTGGCTTATAAAAGAAATGCCC -3'

Posted On

2013-04-24