Incidental Mutation 'R0357:Dzip1'
ID 29907
Institutional Source Beutler Lab
Gene Symbol Dzip1
Ensembl Gene ENSMUSG00000042156
Gene Name DAZ interacting protein 1
Synonyms 2510025K24Rik, 2810422M04Rik
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 118875520-118925460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118909538 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 320 (I320F)
Ref Sequence ENSEMBL: ENSMUSP00000039689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004055] [ENSMUST00000047208]
AlphaFold Q8BMD2
Predicted Effect probably damaging
Transcript: ENSMUST00000004055
AA Change: I320F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004055
Gene: ENSMUSG00000042156
AA Change: I320F

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.6e-45 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047208
AA Change: I320F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039689
Gene: ENSMUSG00000042156
AA Change: I320F

DomainStartEndE-ValueType
Pfam:Dzip-like_N 43 163 3.7e-46 PFAM
ZnF_C2H2 183 206 2.09e-3 SMART
coiled coil region 214 249 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
coiled coil region 385 427 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 481 496 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228157
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a zinc finger protein that has been demonstrated to interact with the deleted in azoospermia (DAZ) protein. DAZ plays an important role early in germ cell development to maintain the initial germ cell population. Deletion of this gene in mice compromises Hedgehog signaling during embryogenesis. Mouse embryos lacking the encoded protein show severe developmental defects with dorsalized neural tubes and underdeveloped somites. Alternative splicing of this gene results in multiple transcript variants. A pseudogene for this gene has been identified on chromosome 5. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted allele lacking exons 2 and 3 exhibit partial embryonic lethality around E9.5, decreased embryo size, underdevelopment of the neural tube and somite and lack of primary cilia on MEFs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Dzip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dzip1 APN 14 118883394 missense probably benign 0.41
IGL01534:Dzip1 APN 14 118877239 missense probably damaging 1.00
IGL01617:Dzip1 APN 14 118881065 missense probably benign 0.16
IGL02537:Dzip1 APN 14 118909576 splice site probably benign
IGL02801:Dzip1 APN 14 118885655 nonsense probably null
IGL03354:Dzip1 APN 14 118912569 splice site probably benign
BB003:Dzip1 UTSW 14 118883499 missense probably benign 0.00
BB013:Dzip1 UTSW 14 118883499 missense probably benign 0.00
PIT4151001:Dzip1 UTSW 14 118922788 missense probably damaging 1.00
R0325:Dzip1 UTSW 14 118909557 missense probably damaging 0.99
R0592:Dzip1 UTSW 14 118902139 missense probably damaging 1.00
R0942:Dzip1 UTSW 14 118887197 nonsense probably null
R1110:Dzip1 UTSW 14 118889305 missense probably benign 0.15
R1458:Dzip1 UTSW 14 118922713 missense probably benign 0.16
R1541:Dzip1 UTSW 14 118879478 missense probably damaging 1.00
R2046:Dzip1 UTSW 14 118922478 missense probably damaging 1.00
R2178:Dzip1 UTSW 14 118889404 splice site probably null
R2316:Dzip1 UTSW 14 118901540 missense probably benign 0.01
R2504:Dzip1 UTSW 14 118881044 missense probably benign 0.11
R2851:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R2852:Dzip1 UTSW 14 118922445 missense possibly damaging 0.71
R3149:Dzip1 UTSW 14 118911368 missense probably benign 0.38
R4111:Dzip1 UTSW 14 118877233 nonsense probably null
R4349:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4350:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4351:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4352:Dzip1 UTSW 14 118883526 missense probably benign 0.00
R4868:Dzip1 UTSW 14 118877214 missense probably damaging 1.00
R5172:Dzip1 UTSW 14 118887151 missense probably damaging 0.97
R5191:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5192:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5376:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5378:Dzip1 UTSW 14 118911393 missense probably damaging 1.00
R5655:Dzip1 UTSW 14 118887232 critical splice acceptor site probably null
R5816:Dzip1 UTSW 14 118909480 missense probably benign 0.00
R7256:Dzip1 UTSW 14 118885646 missense probably benign 0.00
R7768:Dzip1 UTSW 14 118879498 missense probably benign 0.11
R7788:Dzip1 UTSW 14 118883393 missense probably benign 0.00
R7926:Dzip1 UTSW 14 118883499 missense probably benign 0.00
R8477:Dzip1 UTSW 14 118901546 missense possibly damaging 0.80
R8816:Dzip1 UTSW 14 118922373 missense probably benign
R8933:Dzip1 UTSW 14 118906914 missense probably damaging 0.98
R9233:Dzip1 UTSW 14 118887223 missense probably benign
R9458:Dzip1 UTSW 14 118911373 missense probably damaging 0.96
R9781:Dzip1 UTSW 14 118911422 missense probably benign 0.35
X0009:Dzip1 UTSW 14 118877214 missense probably damaging 0.98
X0026:Dzip1 UTSW 14 118922457 missense probably damaging 1.00
Z1177:Dzip1 UTSW 14 118911376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTGCTGGGAACGAACTCATTAAG -3'
(R):5'- CCTCTGACATGGACATGGGCATAC -3'

Sequencing Primer
(F):5'- atccagtgccctcctcc -3'
(R):5'- catgggcataccctggc -3'
Posted On 2013-04-24