Incidental Mutation 'R0357:Cyp4f13'
ID 29911
Institutional Source Beutler Lab
Gene Symbol Cyp4f13
Ensembl Gene ENSMUSG00000024055
Gene Name cytochrome P450, family 4, subfamily f, polypeptide 13
Synonyms 0610030I10Rik, P450 CYP4F13, leukotriene B4 omega hydroxylase
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R0357 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 32924688-32947402 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 32932651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 125 (Y125*)
Ref Sequence ENSEMBL: ENSMUSP00000074733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075253] [ENSMUST00000137222] [ENSMUST00000139353] [ENSMUST00000141325] [ENSMUST00000145683]
AlphaFold Q99N19
Predicted Effect probably null
Transcript: ENSMUST00000075253
AA Change: Y125*
SMART Domains Protein: ENSMUSP00000074733
Gene: ENSMUSG00000024055
AA Change: Y125*

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 52 514 1.9e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137222
SMART Domains Protein: ENSMUSP00000123495
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139353
SMART Domains Protein: ENSMUSP00000123282
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 60 405 7.8e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141325
SMART Domains Protein: ENSMUSP00000117168
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1e9xa_ 48 115 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145683
SMART Domains Protein: ENSMUSP00000118919
Gene: ENSMUSG00000024055

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F3, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F8, is approximately 18 kb away. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
AI837181 C T 19: 5,426,703 T298I possibly damaging Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in Cyp4f13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Cyp4f13 APN 17 32941164 missense probably benign 0.00
IGL01835:Cyp4f13 APN 17 32930614 missense probably benign 0.39
IGL02234:Cyp4f13 APN 17 32924774 utr 3 prime probably benign
IGL02437:Cyp4f13 APN 17 32930608 missense probably benign 0.12
IGL02465:Cyp4f13 APN 17 32929136 critical splice donor site probably null
IGL02604:Cyp4f13 APN 17 32932421 missense probably benign 0.01
IGL02934:Cyp4f13 APN 17 32929871 missense probably damaging 1.00
IGL03177:Cyp4f13 APN 17 32946914 missense possibly damaging 0.88
R0117:Cyp4f13 UTSW 17 32930606 missense probably damaging 0.98
R0138:Cyp4f13 UTSW 17 32941106 missense possibly damaging 0.63
R0220:Cyp4f13 UTSW 17 32929502 missense probably damaging 1.00
R0243:Cyp4f13 UTSW 17 32924969 splice site probably benign
R1078:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R1757:Cyp4f13 UTSW 17 32929958 missense probably damaging 1.00
R1990:Cyp4f13 UTSW 17 32925568 missense probably damaging 1.00
R2351:Cyp4f13 UTSW 17 32925596 missense probably benign 0.01
R4704:Cyp4f13 UTSW 17 32925735 missense probably damaging 1.00
R4865:Cyp4f13 UTSW 17 32925704 missense probably damaging 1.00
R5004:Cyp4f13 UTSW 17 32925786 missense probably benign 0.39
R5310:Cyp4f13 UTSW 17 32925821 missense probably damaging 1.00
R5574:Cyp4f13 UTSW 17 32929205 missense probably benign 0.39
R5996:Cyp4f13 UTSW 17 32929473 missense possibly damaging 0.87
R6190:Cyp4f13 UTSW 17 32929873 missense probably damaging 1.00
R8254:Cyp4f13 UTSW 17 32929933 missense probably benign 0.04
R8495:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8496:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R8498:Cyp4f13 UTSW 17 32924859 missense probably damaging 1.00
R9067:Cyp4f13 UTSW 17 32924827 missense probably damaging 1.00
R9225:Cyp4f13 UTSW 17 32925345 missense probably damaging 1.00
R9225:Cyp4f13 UTSW 17 32929201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTTGTCACCAGCACTCATCAG -3'
(R):5'- TTTTGGGGCAGCCAAGGAAGAC -3'

Sequencing Primer
(F):5'- GCACTCATCAGGAGCCC -3'
(R):5'- CATATGTCCCAGGATGTCTCAGG -3'
Posted On 2013-04-24