Incidental Mutation 'R0357:AI837181'
ID29914
Institutional Source Beutler Lab
Gene Symbol AI837181
Ensembl Gene ENSMUSG00000047423
Gene Nameexpressed sequence AI837181
Synonyms
MMRRC Submission 038563-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0357 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5425157-5427313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5426703 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 298 (T298I)
Ref Sequence ENSEMBL: ENSMUSP00000125651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025853] [ENSMUST00000113673] [ENSMUST00000113674] [ENSMUST00000136579] [ENSMUST00000148219] [ENSMUST00000159759]
Predicted Effect probably benign
Transcript: ENSMUST00000025853
SMART Domains Protein: ENSMUSP00000025853
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:Histone 4 76 2.1e-8 PFAM
Pfam:CBFD_NFYB_HMF 10 74 1e-20 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054477
Predicted Effect probably benign
Transcript: ENSMUST00000113673
SMART Domains Protein: ENSMUSP00000109303
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 1 54 6.7e-14 PFAM
Pfam:Histone 1 56 1.8e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113674
SMART Domains Protein: ENSMUSP00000109304
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 10 74 5e-22 PFAM
low complexity region 114 130 N/A INTRINSIC
low complexity region 141 162 N/A INTRINSIC
low complexity region 179 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134697
Predicted Effect probably benign
Transcript: ENSMUST00000136579
SMART Domains Protein: ENSMUSP00000133692
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:CBFD_NFYB_HMF 1 54 8.7e-14 PFAM
Pfam:Histone 1 56 2.3e-6 PFAM
low complexity region 83 103 N/A INTRINSIC
low complexity region 114 135 N/A INTRINSIC
low complexity region 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148219
SMART Domains Protein: ENSMUSP00000121162
Gene: ENSMUSG00000024914

DomainStartEndE-ValueType
Pfam:Histone 4 76 9.4e-10 PFAM
Pfam:CBFD_NFYB_HMF 10 74 4.5e-22 PFAM
low complexity region 103 123 N/A INTRINSIC
low complexity region 134 155 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159759
AA Change: T298I

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125651
Gene: ENSMUSG00000047423
AA Change: T298I

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
low complexity region 44 64 N/A INTRINSIC
low complexity region 69 82 N/A INTRINSIC
Pfam:DUF1917 139 259 6.1e-19 PFAM
Meta Mutation Damage Score 0.2118 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 89.3%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T C 18: 12,179,209 S169P possibly damaging Het
4930402H24Rik A T 2: 130,712,946 probably benign Het
4931428F04Rik A T 8: 105,285,067 V222E probably damaging Het
4932431P20Rik A T 7: 29,535,582 noncoding transcript Het
9230019H11Rik A T 10: 3,120,307 noncoding transcript Het
9230019H11Rik A G 10: 3,125,788 noncoding transcript Het
Abcf2 T C 5: 24,573,465 K232E probably benign Het
Alox12 T C 11: 70,242,536 Y614C probably damaging Het
Amn A T 12: 111,274,141 probably null Het
Ankrd33b A G 15: 31,305,126 S121P probably benign Het
Aox1 A G 1: 58,092,516 Y1028C probably damaging Het
Asph C A 4: 9,453,314 R736L probably benign Het
Atp2a3 G A 11: 72,970,931 probably null Het
Cables2 T C 2: 180,262,232 probably benign Het
Catsperg2 A T 7: 29,714,901 Y360N possibly damaging Het
Ccdc129 T A 6: 55,968,034 M580K probably benign Het
Cd163l1 T G 7: 140,227,895 C660G probably damaging Het
Cdh4 T C 2: 179,847,340 S282P probably damaging Het
Col5a3 C T 9: 20,807,768 probably benign Het
Ctso A T 3: 81,951,543 probably benign Het
Cyp4f13 A T 17: 32,932,651 Y125* probably null Het
Dapk1 T A 13: 60,729,558 L537* probably null Het
Ddit4l G A 3: 137,626,185 R104Q probably benign Het
Def6 C T 17: 28,223,935 H322Y probably damaging Het
Dnah6 T C 6: 73,188,359 N588D probably benign Het
Dzip1 T A 14: 118,909,538 I320F probably damaging Het
Epb41l5 T C 1: 119,609,204 H319R probably damaging Het
Erc2 A G 14: 27,777,022 E285G probably damaging Het
Fam109b C T 15: 82,343,316 A12V probably damaging Het
Fat4 G A 3: 38,891,227 G1423E probably damaging Het
Foxp2 C T 6: 15,409,840 P480S probably damaging Het
Gadd45gip1 G A 8: 84,834,133 A126T probably damaging Het
Gbp5 G A 3: 142,505,411 D301N probably benign Het
Gm10360 T C 6: 70,424,313 noncoding transcript Het
Gm6471 T A 7: 142,833,867 noncoding transcript Het
Gm8674 T A 13: 49,902,113 noncoding transcript Het
Hist2h2bb A C 3: 96,269,788 K13Q probably null Het
Ift172 A G 5: 31,257,900 S1322P possibly damaging Het
Ift80 A T 3: 68,914,653 Y686* probably null Het
Insrr A C 3: 87,808,646 probably null Het
Krt83 C T 15: 101,487,019 V399M probably benign Het
Macf1 T C 4: 123,457,983 N3708S probably damaging Het
Mogat1 T C 1: 78,512,040 S27P probably benign Het
Mrgpra4 A T 7: 47,981,826 M9K probably benign Het
Mtus1 A T 8: 41,083,526 S384R possibly damaging Het
Myo1a T A 10: 127,710,902 M306K probably benign Het
Noxa1 G T 2: 25,085,850 D403E probably damaging Het
Ogdhl T C 14: 32,346,458 V884A possibly damaging Het
Olfr1335 A C 4: 118,809,417 L149R probably damaging Het
Olfr1392 A G 11: 49,293,786 N155S probably damaging Het
Olfr424 T A 1: 174,137,299 L185* probably null Het
Olfr429 T C 1: 174,089,109 V23A possibly damaging Het
Paxip1 G A 5: 27,758,623 probably benign Het
Paxx T A 2: 25,460,067 E145D probably damaging Het
Pde4d T C 13: 109,951,268 V560A possibly damaging Het
Plxnd1 C T 6: 115,969,460 V847M probably benign Het
Polk T A 13: 96,504,597 M151L probably damaging Het
Ptprq C T 10: 107,686,199 probably benign Het
Pum2 A G 12: 8,721,785 Q371R possibly damaging Het
Reln G A 5: 21,950,822 A2224V probably damaging Het
Shroom1 A G 11: 53,465,208 T362A probably damaging Het
Smarcd2 A G 11: 106,267,332 probably null Het
Spg11 A C 2: 122,066,232 probably benign Het
Tcaf3 T A 6: 42,589,827 Y776F probably damaging Het
Thada A G 17: 84,230,936 V1548A probably damaging Het
Trpv2 C T 11: 62,590,304 P410S probably damaging Het
Ube2u G T 4: 100,481,654 E39* probably null Het
Vmn2r2 C T 3: 64,133,899 probably null Het
Vmn2r24 TCC TC 6: 123,815,410 probably null Het
Zfp110 A G 7: 12,836,375 Y43C probably damaging Het
Zfp605 A G 5: 110,124,379 T55A probably benign Het
Other mutations in AI837181
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:AI837181 UTSW 19 5425231 small insertion probably benign
FR4548:AI837181 UTSW 19 5425237 small insertion probably benign
FR4976:AI837181 UTSW 19 5425229 small insertion probably benign
R1944:AI837181 UTSW 19 5426229 missense probably damaging 0.96
R4846:AI837181 UTSW 19 5426301 missense probably benign 0.23
R7269:AI837181 UTSW 19 5426434 missense probably damaging 1.00
R7561:AI837181 UTSW 19 5426463 missense probably damaging 1.00
R7761:AI837181 UTSW 19 5426291 missense probably benign 0.03
RF002:AI837181 UTSW 19 5425234 small insertion probably benign
RF002:AI837181 UTSW 19 5425235 small insertion probably benign
RF008:AI837181 UTSW 19 5425238 small insertion probably benign
RF009:AI837181 UTSW 19 5425234 small insertion probably benign
RF011:AI837181 UTSW 19 5425236 small insertion probably benign
RF012:AI837181 UTSW 19 5425227 small insertion probably benign
RF013:AI837181 UTSW 19 5425232 small insertion probably benign
RF021:AI837181 UTSW 19 5425234 small insertion probably benign
RF025:AI837181 UTSW 19 5425226 small insertion probably benign
RF026:AI837181 UTSW 19 5425224 small insertion probably benign
RF030:AI837181 UTSW 19 5425226 small insertion probably benign
RF030:AI837181 UTSW 19 5425235 small insertion probably benign
RF031:AI837181 UTSW 19 5425218 small insertion probably benign
RF033:AI837181 UTSW 19 5425224 small insertion probably benign
RF033:AI837181 UTSW 19 5425237 small insertion probably benign
RF035:AI837181 UTSW 19 5425238 small insertion probably benign
RF038:AI837181 UTSW 19 5425226 small insertion probably benign
RF038:AI837181 UTSW 19 5425236 small insertion probably benign
RF041:AI837181 UTSW 19 5425229 small insertion probably benign
RF042:AI837181 UTSW 19 5425217 small insertion probably benign
RF042:AI837181 UTSW 19 5425237 small insertion probably benign
RF045:AI837181 UTSW 19 5425218 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- ATTCACCTGTCACCTGGCTTCAAG -3'
(R):5'- AGTTGGCCCTGCACAAAGAGAG -3'

Sequencing Primer
(F):5'- GAAGCAGATTCTGCCATTCG -3'
(R):5'- CCTGCACAAAGAGAGCAGAAG -3'
Posted On2013-04-24