Incidental Mutation 'R0358:Terf1'
ID29915
Institutional Source Beutler Lab
Gene Symbol Terf1
Ensembl Gene ENSMUSG00000025925
Gene Nametelomeric repeat binding factor 1
SynonymsTrbf1, Trf1, Pin2
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0358 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location15805646-15844052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15805838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 54 (V54A)
Ref Sequence ENSEMBL: ENSMUSP00000027057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027057] [ENSMUST00000188371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027057
AA Change: V54A

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027057
Gene: ENSMUSG00000025925
AA Change: V54A

DomainStartEndE-ValueType
Pfam:TRF 61 257 2.3e-28 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186565
Predicted Effect possibly damaging
Transcript: ENSMUST00000188371
AA Change: V54A

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140744
Gene: ENSMUSG00000025925
AA Change: V54A

DomainStartEndE-ValueType
Pfam:TRF 61 258 3e-30 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188684
Meta Mutation Damage Score 0.0920 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a protein that binds to repeats in telomeres to form a nucleoprotein complex that protects against the degradation of chromosomal ends. The encoded protein regulates the length of telomeres and is an integral structural component of the functional telomere. This protein is thought to play a role in spindle formation in mitosis. Mutations in this gene are associated with bone marrow failure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality and die sometime before E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Ache A G 5: 137,290,373 T114A probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Atp6v1c2 T C 12: 17,284,960 probably benign Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Gpr22 T C 12: 31,709,982 N47S probably benign Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Nup214 G A 2: 32,004,300 probably null Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr149 A G 9: 39,702,001 I256T possibly damaging Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptk6 G T 2: 181,198,522 H230Q probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Slc22a16 T G 10: 40,587,492 probably null Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Terf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Terf1 APN 1 15833402 missense probably damaging 1.00
R0369:Terf1 UTSW 1 15818983 missense probably damaging 1.00
R1471:Terf1 UTSW 1 15842970 missense probably damaging 1.00
R1853:Terf1 UTSW 1 15818938 nonsense probably null
R1942:Terf1 UTSW 1 15805814 missense probably benign 0.34
R2029:Terf1 UTSW 1 15805946 missense possibly damaging 0.82
R2132:Terf1 UTSW 1 15805685 missense probably benign 0.02
R2391:Terf1 UTSW 1 15805739 nonsense probably null
R4255:Terf1 UTSW 1 15805679 start codon destroyed probably null 1.00
R4685:Terf1 UTSW 1 15818961 missense possibly damaging 0.80
R5291:Terf1 UTSW 1 15819086 splice site probably null
R5310:Terf1 UTSW 1 15805685 missense probably damaging 0.97
R5338:Terf1 UTSW 1 15831563 missense possibly damaging 0.48
R5661:Terf1 UTSW 1 15819664 missense probably damaging 1.00
R6216:Terf1 UTSW 1 15818997 missense probably benign 0.09
R6719:Terf1 UTSW 1 15838236 missense probably benign 0.01
R7126:Terf1 UTSW 1 15813139 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCGGTTTAACATGGCGGAGACG -3'
(R):5'- ACTTCCAGCAAACAGGAAGCGG -3'

Sequencing Primer
(F):5'- AGACGGTCTCCTCAGCG -3'
(R):5'- ACGAGTACGACGAAAGTCCT -3'
Posted On2013-04-24