Mutagenetix > Incidental Mutation

Incidental Mutation 'R0358:Nup214'

29920

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

038564-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31864446-31943204 bp(+) (GRCm39)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 31894312 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000141436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000065398] [ENSMUST00000065398] [ENSMUST00000126301] [ENSMUST00000126301] [ENSMUST00000126301]

AlphaFold

Q80U93

Predicted Effect

probably null
Transcript: ENSMUST00000065398

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000065398

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000065398

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000126301

SMART Domains

Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000126301

SMART Domains

Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000126301

SMART Domains

Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.2%
20x: 88.5%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	G	A	17: 79,935,585 (GRCm39)		probably benign	Het
Abca16	A	T	7: 120,143,939 (GRCm39)	K1651N	probably benign	Het
Abcb1b	T	C	5: 8,871,423 (GRCm39)	S326P	probably benign	Het
Ache	A	G	5: 137,288,635 (GRCm39)	T114A	probably benign	Het
Akap3	T	A	6: 126,843,775 (GRCm39)	V798D	probably damaging	Het
Ankle1	A	G	8: 71,860,189 (GRCm39)	T256A	probably damaging	Het
Aqp4	T	C	18: 15,531,302 (GRCm39)	N153S	probably benign	Het
Arhgap23	G	A	11: 97,354,414 (GRCm39)	V265M	probably damaging	Het
Arhgef25	A	T	10: 127,020,322 (GRCm39)	M326K	probably damaging	Het
Atp6v1c2	T	C	12: 17,334,961 (GRCm39)		probably benign	Het
Cars1	A	T	7: 143,142,219 (GRCm39)		probably benign	Het
Cep83	A	T	10: 94,555,593 (GRCm39)	M96L	probably benign	Het
Cfap46	A	G	7: 139,231,449 (GRCm39)		probably benign	Het
Cnnm3	T	A	1: 36,560,303 (GRCm39)	S608T	probably damaging	Het
Cul7	G	A	17: 46,974,670 (GRCm39)		probably null	Het
Dhrs2	G	A	14: 55,473,574 (GRCm39)	V78M	probably damaging	Het
Dhx38	A	T	8: 110,279,094 (GRCm39)	D1051E	probably benign	Het
Eftud2	A	G	11: 102,755,627 (GRCm39)		probably benign	Het
Egln3	T	C	12: 54,250,082 (GRCm39)	E89G	possibly damaging	Het
Eif2ak4	A	G	2: 118,294,410 (GRCm39)		probably null	Het
Fbxl17	G	A	17: 63,663,846 (GRCm39)	R67C	probably damaging	Het
Fsip2	A	T	2: 82,813,677 (GRCm39)	N3332I	possibly damaging	Het
Gbp2b	A	T	3: 142,312,550 (GRCm39)	E311V	probably damaging	Het
Gcnt2	G	T	13: 41,014,329 (GRCm39)	A167S	probably damaging	Het
Gm9797	A	T	10: 11,485,088 (GRCm39)		noncoding transcript	Het
Gpatch3	A	G	4: 133,305,215 (GRCm39)		probably null	Het
Gpr22	T	C	12: 31,759,981 (GRCm39)	N47S	probably benign	Het
Il18rap	A	T	1: 40,588,202 (GRCm39)	H600L	possibly damaging	Het
Larp7	A	G	3: 127,340,737 (GRCm39)		probably null	Het
Mep1a	A	G	17: 43,789,841 (GRCm39)	Y490H	possibly damaging	Het
Mrgprh	T	A	17: 13,096,237 (GRCm39)	V159D	probably damaging	Het
Mylk	G	C	16: 34,699,845 (GRCm39)	E403Q	possibly damaging	Het
Nrbp1	T	A	5: 31,402,231 (GRCm39)	I64N	probably damaging	Het
Or10d1b	A	G	9: 39,613,297 (GRCm39)	I256T	possibly damaging	Het
Or13a21	G	T	7: 139,998,856 (GRCm39)	L277M	probably damaging	Het
Or2o1	T	A	11: 49,051,071 (GRCm39)	C77S	probably benign	Het
Or4k15b	A	T	14: 50,272,743 (GRCm39)	L39Q	probably damaging	Het
Pef1	A	G	4: 130,021,180 (GRCm39)	T245A	probably damaging	Het
Phrf1	A	G	7: 140,838,217 (GRCm39)		probably benign	Het
Ppig	A	G	2: 69,573,942 (GRCm39)		probably benign	Het
Ppp1r8	G	T	4: 132,562,039 (GRCm39)	F60L	probably damaging	Het
Psmd11	G	A	11: 80,353,510 (GRCm39)		probably benign	Het
Ptk6	G	T	2: 180,840,315 (GRCm39)	H230Q	probably benign	Het
Ptprd	T	C	4: 75,863,226 (GRCm39)	Y1496C	probably damaging	Het
Rhbdl3	G	T	11: 80,244,457 (GRCm39)	W388L	probably damaging	Het
Rnf130	T	A	11: 49,962,109 (GRCm39)	M185K	probably benign	Het
S100a13	A	T	3: 90,423,299 (GRCm39)	I97F	probably damaging	Het
Slc22a16	T	G	10: 40,463,488 (GRCm39)		probably null	Het
Tcte1	A	T	17: 45,846,211 (GRCm39)	T272S	probably benign	Het
Terf1	T	C	1: 15,876,062 (GRCm39)	V54A	possibly damaging	Het
Tmem63a	T	A	1: 180,783,988 (GRCm39)	N189K	probably benign	Het
Trim32	G	A	4: 65,531,491 (GRCm39)	R16Q	probably damaging	Het
Trim66	G	A	7: 109,059,383 (GRCm39)	Q954*	probably null	Het
Trpv4	A	G	5: 114,768,493 (GRCm39)	F525S	probably damaging	Het
Ttll7	A	G	3: 146,649,871 (GRCm39)	T634A	probably benign	Het
Tut7	T	C	13: 59,929,918 (GRCm39)	D47G	probably damaging	Het
Ush2a	T	G	1: 188,269,977 (GRCm39)	N1741K	possibly damaging	Het
Wdr87-ps	A	T	7: 29,231,636 (GRCm39)		noncoding transcript	Het
Zfp451	T	A	1: 33,816,810 (GRCm39)	H163L	probably damaging	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	31,923,991 (GRCm39)	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	31,896,733 (GRCm39)	missense	probably benign	0.27
IGL01149:Nup214	APN	2	31,924,712 (GRCm39)	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	31,928,190 (GRCm39)	unclassified	probably benign
IGL01409:Nup214	APN	2	31,916,943 (GRCm39)	splice site	probably null
IGL01530:Nup214	APN	2	31,923,733 (GRCm39)	missense	probably benign
IGL01554:Nup214	APN	2	31,941,084 (GRCm39)	nonsense	probably null
IGL01944:Nup214	APN	2	31,924,971 (GRCm39)	nonsense	probably null
IGL02296:Nup214	APN	2	31,878,200 (GRCm39)	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31,867,872 (GRCm39)	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	31,921,287 (GRCm39)	missense	probably benign
IGL02858:Nup214	APN	2	31,900,384 (GRCm39)	splice site	probably benign
IGL02953:Nup214	APN	2	31,878,241 (GRCm39)	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	31,908,254 (GRCm39)	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31,886,452 (GRCm39)	missense	probably benign	0.27
IGL03225:Nup214	APN	2	31,924,423 (GRCm39)	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	31,900,233 (GRCm39)	missense	probably damaging	0.97
Des_moines	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
ANU74:Nup214	UTSW	2	31,924,978 (GRCm39)	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31,880,379 (GRCm39)	splice site	probably null
R0243:Nup214	UTSW	2	31,888,069 (GRCm39)	splice site	probably benign
R0270:Nup214	UTSW	2	31,924,826 (GRCm39)	missense	probably damaging	0.96
R1168:Nup214	UTSW	2	31,915,313 (GRCm39)	missense	probably benign
R1242:Nup214	UTSW	2	31,867,782 (GRCm39)	missense	probably benign	0.00
R1481:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1581:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1610:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31,886,392 (GRCm39)	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	31,924,478 (GRCm39)	missense	probably damaging	1.00
R2293:Nup214	UTSW	2	31,916,887 (GRCm39)	missense	probably benign
R2924:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31,888,015 (GRCm39)	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31,866,632 (GRCm39)	missense	probably benign	0.00
R3426:Nup214	UTSW	2	31,923,415 (GRCm39)	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	31,924,694 (GRCm39)	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	31,941,112 (GRCm39)	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31,884,696 (GRCm39)	missense	probably benign
R4353:Nup214	UTSW	2	31,867,929 (GRCm39)	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31,887,977 (GRCm39)	missense	probably benign	0.36
R4626:Nup214	UTSW	2	31,923,416 (GRCm39)	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31,870,596 (GRCm39)	splice site	probably null
R4938:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31,873,171 (GRCm39)	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31,881,329 (GRCm39)	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	31,907,158 (GRCm39)	missense	unknown
R5406:Nup214	UTSW	2	31,892,619 (GRCm39)	missense	probably damaging	0.96
R5507:Nup214	UTSW	2	31,878,188 (GRCm39)	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	31,924,385 (GRCm39)	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	31,900,308 (GRCm39)	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31,881,353 (GRCm39)	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31,869,790 (GRCm39)	missense	possibly damaging	0.52
R6140:Nup214	UTSW	2	31,941,808 (GRCm39)	missense	possibly damaging	0.92
R6243:Nup214	UTSW	2	31,892,944 (GRCm39)	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31,881,384 (GRCm39)	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31,872,683 (GRCm39)	nonsense	probably null
R6970:Nup214	UTSW	2	31,941,810 (GRCm39)	missense	probably damaging	1.00
R7028:Nup214	UTSW	2	31,924,168 (GRCm39)	missense	probably benign	0.22
R7114:Nup214	UTSW	2	31,915,256 (GRCm39)	missense	possibly damaging	0.83
R7120:Nup214	UTSW	2	31,941,054 (GRCm39)	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31,878,245 (GRCm39)	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	31,916,917 (GRCm39)	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	31,923,362 (GRCm39)	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31,884,738 (GRCm39)	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31,886,458 (GRCm39)	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31,880,266 (GRCm39)	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	31,929,372 (GRCm39)	missense	probably benign	0.05
R8785:Nup214	UTSW	2	31,924,465 (GRCm39)	missense	probably damaging	0.97
R9257:Nup214	UTSW	2	31,923,347 (GRCm39)	missense	possibly damaging	0.92
R9291:Nup214	UTSW	2	31,867,806 (GRCm39)	missense	probably benign	0.00
R9376:Nup214	UTSW	2	31,924,244 (GRCm39)	missense	probably benign	0.00
R9408:Nup214	UTSW	2	31,937,523 (GRCm39)	missense	probably damaging	1.00
R9613:Nup214	UTSW	2	31,901,035 (GRCm39)	missense	possibly damaging	0.90
R9789:Nup214	UTSW	2	31,907,227 (GRCm39)	missense	possibly damaging	0.46
RF015:Nup214	UTSW	2	31,924,718 (GRCm39)	missense	probably benign	0.00
X0026:Nup214	UTSW	2	31,910,318 (GRCm39)	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	31,932,488 (GRCm39)	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	31,901,235 (GRCm39)	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	31,924,237 (GRCm39)	nonsense	probably null
Z1176:Nup214	UTSW	2	31,900,270 (GRCm39)	missense	possibly damaging	0.66
Z1177:Nup214	UTSW	2	31,887,971 (GRCm39)	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ACGAGAAAGTCCCTCATGGAGCTG -3'
(R):5'- AAGCTCACTGCTTCTGAACCCGTC -3'

Sequencing Primer
(F):5'- cgggaagcagaggcagg -3'
(R):5'- TCTGAACCCGTCTTGACAGAG -3'

Posted On

2013-04-24