Incidental Mutation 'R0358:Nup214'
ID29920
Institutional Source Beutler Lab
Gene Symbol Nup214
Ensembl Gene ENSMUSG00000001855
Gene Namenucleoporin 214
SynonymsCAN, D2H9S46E
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0358 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31974436-32053975 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 32004300 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000065398] [ENSMUST00000065398] [ENSMUST00000126301] [ENSMUST00000126301] [ENSMUST00000126301]
Predicted Effect probably null
Transcript: ENSMUST00000065398
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000065398
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000065398
SMART Domains Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855

DomainStartEndE-ValueType
WD40 138 178 2.48e0 SMART
WD40 182 220 2.67e-1 SMART
low complexity region 428 441 N/A INTRINSIC
low complexity region 449 467 N/A INTRINSIC
low complexity region 474 493 N/A INTRINSIC
low complexity region 529 546 N/A INTRINSIC
low complexity region 620 640 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
coiled coil region 853 881 N/A INTRINSIC
internal_repeat_1 969 993 1.13e-9 PROSPERO
internal_repeat_1 985 1009 1.13e-9 PROSPERO
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1049 1064 N/A INTRINSIC
low complexity region 1093 1111 N/A INTRINSIC
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1226 1248 N/A INTRINSIC
low complexity region 1279 1296 N/A INTRINSIC
low complexity region 1300 1311 N/A INTRINSIC
low complexity region 1391 1426 N/A INTRINSIC
low complexity region 1438 1454 N/A INTRINSIC
low complexity region 1458 1505 N/A INTRINSIC
low complexity region 1559 1573 N/A INTRINSIC
low complexity region 1611 1642 N/A INTRINSIC
low complexity region 1658 1670 N/A INTRINSIC
low complexity region 1686 1715 N/A INTRINSIC
low complexity region 1733 1748 N/A INTRINSIC
low complexity region 1771 1783 N/A INTRINSIC
low complexity region 1799 1832 N/A INTRINSIC
low complexity region 1853 1872 N/A INTRINSIC
low complexity region 1877 1886 N/A INTRINSIC
low complexity region 1898 1910 N/A INTRINSIC
low complexity region 1925 1934 N/A INTRINSIC
low complexity region 1969 1995 N/A INTRINSIC
low complexity region 2007 2032 N/A INTRINSIC
low complexity region 2048 2076 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126301
SMART Domains Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126301
SMART Domains Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126301
SMART Domains Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Ache A G 5: 137,290,373 T114A probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Atp6v1c2 T C 12: 17,284,960 probably benign Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Gpr22 T C 12: 31,709,982 N47S probably benign Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr149 A G 9: 39,702,001 I256T possibly damaging Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptk6 G T 2: 181,198,522 H230Q probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Slc22a16 T G 10: 40,587,492 probably null Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Terf1 T C 1: 15,805,838 V54A possibly damaging Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Nup214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Nup214 APN 2 32033979 missense probably damaging 1.00
IGL00649:Nup214 APN 2 32006721 missense probably benign 0.27
IGL01149:Nup214 APN 2 32034700 missense probably damaging 1.00
IGL01360:Nup214 APN 2 32038178 unclassified probably benign
IGL01409:Nup214 APN 2 32026931 splice site probably null
IGL01530:Nup214 APN 2 32033721 missense probably benign
IGL01554:Nup214 APN 2 32051072 nonsense probably null
IGL01944:Nup214 APN 2 32034959 nonsense probably null
IGL02296:Nup214 APN 2 31988188 missense possibly damaging 0.65
IGL02563:Nup214 APN 2 31977860 missense probably damaging 1.00
IGL02688:Nup214 APN 2 32031275 missense probably benign
IGL02858:Nup214 APN 2 32010372 splice site probably benign
IGL02953:Nup214 APN 2 31988229 missense possibly damaging 0.87
IGL03090:Nup214 APN 2 32018242 missense probably benign 0.01
IGL03124:Nup214 APN 2 31996440 missense probably benign 0.27
IGL03225:Nup214 APN 2 32034411 missense probably damaging 1.00
IGL03375:Nup214 APN 2 32010221 missense probably damaging 0.97
Des_moines UTSW 2 31980584 splice site probably null
ANU74:Nup214 UTSW 2 32034966 missense probably damaging 0.99
R0035:Nup214 UTSW 2 31990367 splice site probably null
R0243:Nup214 UTSW 2 31998057 splice site probably benign
R0270:Nup214 UTSW 2 32034814 missense probably damaging 0.96
R1168:Nup214 UTSW 2 32025301 missense probably benign
R1242:Nup214 UTSW 2 31977770 missense probably benign 0.00
R1481:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1482:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1579:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1580:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1581:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1610:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R1894:Nup214 UTSW 2 31996380 missense possibly damaging 0.66
R2146:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2149:Nup214 UTSW 2 32034466 missense probably damaging 1.00
R2293:Nup214 UTSW 2 32026875 missense probably benign
R2924:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R2925:Nup214 UTSW 2 31998003 missense probably damaging 1.00
R3037:Nup214 UTSW 2 31976620 missense probably benign 0.00
R3426:Nup214 UTSW 2 32033403 missense probably damaging 0.97
R3799:Nup214 UTSW 2 32034682 missense probably damaging 1.00
R3843:Nup214 UTSW 2 32051100 missense probably damaging 1.00
R4323:Nup214 UTSW 2 31994684 missense probably benign
R4353:Nup214 UTSW 2 31977917 critical splice donor site probably null
R4601:Nup214 UTSW 2 31997965 missense probably benign 0.36
R4626:Nup214 UTSW 2 32033404 missense possibly damaging 0.92
R4874:Nup214 UTSW 2 31980584 splice site probably null
R4938:Nup214 UTSW 2 31983159 missense probably benign 0.00
R4939:Nup214 UTSW 2 31983159 missense probably benign 0.00
R5027:Nup214 UTSW 2 31991317 missense probably damaging 1.00
R5358:Nup214 UTSW 2 32017146 missense unknown
R5406:Nup214 UTSW 2 32002607 missense probably damaging 0.96
R5507:Nup214 UTSW 2 31988176 missense possibly damaging 0.87
R5695:Nup214 UTSW 2 32034373 missense probably damaging 1.00
R5744:Nup214 UTSW 2 32010296 missense probably damaging 0.97
R5908:Nup214 UTSW 2 31991341 missense probably benign 0.03
R5967:Nup214 UTSW 2 31979778 missense possibly damaging 0.52
R6140:Nup214 UTSW 2 32051796 missense possibly damaging 0.92
R6243:Nup214 UTSW 2 32002932 missense possibly damaging 0.81
R6488:Nup214 UTSW 2 31991372 missense possibly damaging 0.93
R6934:Nup214 UTSW 2 31982671 nonsense probably null
R6970:Nup214 UTSW 2 32051798 missense probably damaging 1.00
R7028:Nup214 UTSW 2 32034156 missense probably benign 0.22
R7114:Nup214 UTSW 2 32025244 missense possibly damaging 0.83
R7120:Nup214 UTSW 2 32051042 missense probably benign 0.07
R7249:Nup214 UTSW 2 31988233 missense possibly damaging 0.92
R7821:Nup214 UTSW 2 32026905 missense possibly damaging 0.83
R8026:Nup214 UTSW 2 32033350 missense possibly damaging 0.55
RF015:Nup214 UTSW 2 32034706 missense probably benign 0.00
X0026:Nup214 UTSW 2 32020306 missense possibly damaging 0.46
X0065:Nup214 UTSW 2 32042476 missense probably damaging 1.00
Z1088:Nup214 UTSW 2 32011223 missense probably benign 0.27
Z1176:Nup214 UTSW 2 32010258 missense possibly damaging 0.66
Z1176:Nup214 UTSW 2 32034225 nonsense probably null
Z1177:Nup214 UTSW 2 31997959 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACGAGAAAGTCCCTCATGGAGCTG -3'
(R):5'- AAGCTCACTGCTTCTGAACCCGTC -3'

Sequencing Primer
(F):5'- cgggaagcagaggcagg -3'
(R):5'- TCTGAACCCGTCTTGACAGAG -3'
Posted On2013-04-24