Incidental Mutation 'R0358:Ptk6'
ID29923
Institutional Source Beutler Lab
Gene Symbol Ptk6
Ensembl Gene ENSMUSG00000038751
Gene NamePTK6 protein tyrosine kinase 6
SynonymsSik, Tksk
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0358 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181193721-181202789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 181198522 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 230 (H230Q)
Ref Sequence ENSEMBL: ENSMUSP00000016511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016511]
Predicted Effect probably benign
Transcript: ENSMUST00000016511
AA Change: H230Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000016511
Gene: ENSMUSG00000038751
AA Change: H230Q

DomainStartEndE-ValueType
SH3 11 71 2e-16 SMART
SH2 76 161 1.01e-28 SMART
TyrKc 191 441 1.12e-131 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null allele display increased villus length in the jejunum and ileum and increased villus epithelial cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Ache A G 5: 137,290,373 T114A probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Atp6v1c2 T C 12: 17,284,960 probably benign Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Gpr22 T C 12: 31,709,982 N47S probably benign Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Nup214 G A 2: 32,004,300 probably null Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr149 A G 9: 39,702,001 I256T possibly damaging Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Slc22a16 T G 10: 40,587,492 probably null Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Terf1 T C 1: 15,805,838 V54A possibly damaging Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Ptk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ptk6 APN 2 181195818 missense probably benign 0.00
IGL01630:Ptk6 APN 2 181197066 missense probably damaging 0.99
IGL01862:Ptk6 APN 2 181199640 missense probably benign 0.00
IGL02231:Ptk6 APN 2 181197001 missense probably damaging 1.00
IGL02965:Ptk6 APN 2 181199068 splice site probably benign
R0115:Ptk6 UTSW 2 181202527 start gained probably benign
R0139:Ptk6 UTSW 2 181196931 splice site probably benign
R0245:Ptk6 UTSW 2 181202491 missense probably benign
R0416:Ptk6 UTSW 2 181202308 missense possibly damaging 0.94
R0454:Ptk6 UTSW 2 181202282 missense possibly damaging 0.86
R0470:Ptk6 UTSW 2 181195939 missense probably benign
R0481:Ptk6 UTSW 2 181202527 start gained probably benign
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1147:Ptk6 UTSW 2 181195797 missense probably benign 0.23
R1234:Ptk6 UTSW 2 181202440 missense possibly damaging 0.94
R2249:Ptk6 UTSW 2 181196380 missense probably benign 0.03
R4842:Ptk6 UTSW 2 181196991 missense possibly damaging 0.89
R5568:Ptk6 UTSW 2 181199695 missense possibly damaging 0.47
R5806:Ptk6 UTSW 2 181199730 missense possibly damaging 0.95
R6017:Ptk6 UTSW 2 181195812 missense probably benign 0.32
R6285:Ptk6 UTSW 2 181197093 missense probably null 1.00
R6293:Ptk6 UTSW 2 181198460 missense probably damaging 1.00
R6468:Ptk6 UTSW 2 181199102 missense probably benign
R7369:Ptk6 UTSW 2 181198461 missense possibly damaging 0.86
X0062:Ptk6 UTSW 2 181202323 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCACGTACCACGCAGTAGC -3'
(R):5'- TCAGGTCAGCCAGGACTTTGAAAAC -3'

Sequencing Primer
(F):5'- AGCTCCGTGATGATGTAGAC -3'
(R):5'- CAGGACTTTGAAAACATCTGGC -3'
Posted On2013-04-24