Incidental Mutation 'R0358:Ache'
ID29935
Institutional Source Beutler Lab
Gene Symbol Ache
Ensembl Gene ENSMUSG00000023328
Gene Nameacetylcholinesterase
Synonyms
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.786) question?
Stock #R0358 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137287519-137294466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137290373 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 114 (T114A)
Ref Sequence ENSEMBL: ENSMUSP00000142427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000125195] [ENSMUST00000132191] [ENSMUST00000137126] [ENSMUST00000138591] [ENSMUST00000141123] [ENSMUST00000196208]
Predicted Effect probably benign
Transcript: ENSMUST00000024099
AA Change: T114A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328
AA Change: T114A

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085934
AA Change: T114A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328
AA Change: T114A

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125195
Predicted Effect probably benign
Transcript: ENSMUST00000132191
Predicted Effect probably benign
Transcript: ENSMUST00000137126
Predicted Effect probably benign
Transcript: ENSMUST00000138591
Predicted Effect probably benign
Transcript: ENSMUST00000141123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect probably benign
Transcript: ENSMUST00000196208
AA Change: T114A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328
AA Change: T114A

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196840
Meta Mutation Damage Score 0.0895 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show retarded postnatal development, tremors, impaired righting response, delayed maturation of external ear, failure of eyelids to open, and die by 3-wk. of age. Mutants are highly sensitive to butyrylcholinesterase inhibitor toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Atp6v1c2 T C 12: 17,284,960 probably benign Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Gpr22 T C 12: 31,709,982 N47S probably benign Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Nup214 G A 2: 32,004,300 probably null Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr149 A G 9: 39,702,001 I256T possibly damaging Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptk6 G T 2: 181,198,522 H230Q probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Slc22a16 T G 10: 40,587,492 probably null Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Terf1 T C 1: 15,805,838 V54A possibly damaging Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Ache
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Ache APN 5 137291064 missense probably damaging 1.00
IGL02833:Ache APN 5 137291109 unclassified probably benign
R0058:Ache UTSW 5 137290842 missense probably damaging 1.00
R0377:Ache UTSW 5 137290928 missense possibly damaging 0.54
R0780:Ache UTSW 5 137290532 missense probably damaging 1.00
R1233:Ache UTSW 5 137290157 unclassified probably null
R1702:Ache UTSW 5 137290989 missense possibly damaging 0.94
R1762:Ache UTSW 5 137290575 missense possibly damaging 0.91
R4191:Ache UTSW 5 137291072 missense probably damaging 0.98
R4226:Ache UTSW 5 137290890 missense possibly damaging 0.83
R4499:Ache UTSW 5 137291932 missense probably damaging 0.98
R4931:Ache UTSW 5 137291914 missense probably benign 0.00
R5411:Ache UTSW 5 137290064 missense possibly damaging 0.93
R5411:Ache UTSW 5 137290430 unclassified probably null
R5698:Ache UTSW 5 137290559 missense probably damaging 1.00
R6153:Ache UTSW 5 137291855 missense probably damaging 1.00
R6526:Ache UTSW 5 137290644 missense probably damaging 1.00
R6896:Ache UTSW 5 137291734 missense probably damaging 0.98
R6981:Ache UTSW 5 137291678 missense probably benign
R7199:Ache UTSW 5 137290242 missense probably damaging 1.00
R7208:Ache UTSW 5 137291489 missense probably damaging 1.00
X0061:Ache UTSW 5 137290095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTGATAAGCCCTGGGCAAGAC -3'
(R):5'- CCAAAGGTTCCCACTCGGTAGTTC -3'

Sequencing Primer
(F):5'- CTGGGCAAGACTGTTTCTTAATC -3'
(R):5'- CCCACTCGGTAGTTCATAGATAC -3'
Posted On2013-04-24