Incidental Mutation 'R0358:Olfr149'
ID29945
Institutional Source Beutler Lab
Gene Symbol Olfr149
Ensembl Gene ENSMUSG00000062121
Gene Nameolfactory receptor 149
SynonymsGA_x6K02T2PVTD-33400306-33399371, MOR224-8, M31
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0358 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39700518-39707117 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39702001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 256 (I256T)
Ref Sequence ENSEMBL: ENSMUSP00000149664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082027] [ENSMUST00000215192]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082027
AA Change: I256T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080686
Gene: ENSMUSG00000062121
AA Change: I256T

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 223 3.8e-9 PFAM
Pfam:7tm_1 39 286 1.2e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215192
AA Change: I256T

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Ache A G 5: 137,290,373 T114A probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Atp6v1c2 T C 12: 17,284,960 probably benign Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Gpr22 T C 12: 31,709,982 N47S probably benign Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Nup214 G A 2: 32,004,300 probably null Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptk6 G T 2: 181,198,522 H230Q probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Slc22a16 T G 10: 40,587,492 probably null Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Terf1 T C 1: 15,805,838 V54A possibly damaging Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Olfr149
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:Olfr149 APN 9 39702253 missense probably damaging 1.00
IGL02707:Olfr149 APN 9 39702641 missense probably damaging 0.99
IGL02730:Olfr149 APN 9 39702238 missense probably damaging 1.00
IGL03375:Olfr149 APN 9 39702575 missense probably damaging 1.00
R0244:Olfr149 UTSW 9 39702173 missense probably damaging 0.97
R4179:Olfr149 UTSW 9 39702091 missense probably benign 0.30
R5120:Olfr149 UTSW 9 39702070 missense probably benign 0.00
R5185:Olfr149 UTSW 9 39701876 missense probably benign
R5818:Olfr149 UTSW 9 39702365 missense probably benign 0.01
R6029:Olfr149 UTSW 9 39702400 missense probably damaging 1.00
R6207:Olfr149 UTSW 9 39702310 missense probably benign 0.06
R6454:Olfr149 UTSW 9 39701834 makesense probably null
R7451:Olfr149 UTSW 9 39702127 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAGCAGATGTAGGACAGTCCAC -3'
(R):5'- GACCGTTTTGTTGCCATATGCTACC -3'

Sequencing Primer
(F):5'- GGACAGTCCACAGTGATGATTTC -3'
(R):5'- TACTGTGGCCCCAAAGATGTG -3'
Posted On2013-04-24