Incidental Mutation 'R0358:Atp6v1c2'
ID29955
Institutional Source Beutler Lab
Gene Symbol Atp6v1c2
Ensembl Gene ENSMUSG00000020566
Gene NameATPase, H+ transporting, lysosomal V1 subunit C2
Synonyms
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R0358 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17284721-17329359 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 17284960 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020884] [ENSMUST00000057288] [ENSMUST00000095820] [ENSMUST00000140751] [ENSMUST00000156727] [ENSMUST00000221129]
Predicted Effect probably benign
Transcript: ENSMUST00000020884
SMART Domains Protein: ENSMUSP00000020884
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 427 3.9e-156 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057288
SMART Domains Protein: ENSMUSP00000052912
Gene: ENSMUSG00000020571

DomainStartEndE-ValueType
Pfam:Thioredoxin 31 134 5.6e-32 PFAM
low complexity region 143 159 N/A INTRINSIC
Pfam:Thioredoxin 166 272 7.4e-33 PFAM
low complexity region 427 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095820
SMART Domains Protein: ENSMUSP00000093500
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 417 3.4e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140751
SMART Domains Protein: ENSMUSP00000123415
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 133 4.1e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156727
SMART Domains Protein: ENSMUSP00000117139
Gene: ENSMUSG00000020566

DomainStartEndE-ValueType
Pfam:V-ATPase_C 1 347 2.5e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162936
Predicted Effect probably benign
Transcript: ENSMUST00000221129
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Ache A G 5: 137,290,373 T114A probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Gpr22 T C 12: 31,709,982 N47S probably benign Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Nup214 G A 2: 32,004,300 probably null Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr149 A G 9: 39,702,001 I256T possibly damaging Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptk6 G T 2: 181,198,522 H230Q probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Slc22a16 T G 10: 40,587,492 probably null Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Terf1 T C 1: 15,805,838 V54A possibly damaging Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Atp6v1c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Atp6v1c2 APN 12 17308293 missense probably damaging 1.00
IGL01520:Atp6v1c2 APN 12 17297753 missense probably damaging 1.00
IGL02121:Atp6v1c2 APN 12 17291440 missense possibly damaging 0.65
IGL02990:Atp6v1c2 APN 12 17294740 missense probably damaging 1.00
IGL03243:Atp6v1c2 APN 12 17289121 missense probably benign 0.07
R0077:Atp6v1c2 UTSW 12 17321612 missense probably damaging 1.00
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0239:Atp6v1c2 UTSW 12 17294675 critical splice donor site probably null
R0373:Atp6v1c2 UTSW 12 17288168 missense probably damaging 1.00
R0536:Atp6v1c2 UTSW 12 17307508 splice site probably null
R1164:Atp6v1c2 UTSW 12 17308316 missense probably damaging 1.00
R1400:Atp6v1c2 UTSW 12 17289130 missense probably benign 0.13
R2133:Atp6v1c2 UTSW 12 17321611 missense probably benign 0.03
R4695:Atp6v1c2 UTSW 12 17301207 missense probably benign 0.02
R4825:Atp6v1c2 UTSW 12 17289060 missense probably benign 0.02
R5215:Atp6v1c2 UTSW 12 17291658 missense probably benign 0.08
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6034:Atp6v1c2 UTSW 12 17307500 missense possibly damaging 0.79
R6196:Atp6v1c2 UTSW 12 17301186 nonsense probably null
R7059:Atp6v1c2 UTSW 12 17289004 nonsense probably null
R7505:Atp6v1c2 UTSW 12 17297723 splice site probably null
R7559:Atp6v1c2 UTSW 12 17301214 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAAACCCCAGTGGGTTGCCAAG -3'
(R):5'- TGCAGCAAGCATACTGGATGTAGG -3'

Sequencing Primer
(F):5'- GACTCAGGACTGAGCACTTTATTG -3'
(R):5'- CAAGCATACTGGATGTAGGTATCAC -3'
Posted On2013-04-24