Incidental Mutation 'R0358:Gpr22'
ID29956
Institutional Source Beutler Lab
Gene Symbol Gpr22
Ensembl Gene ENSMUSG00000044067
Gene NameG protein-coupled receptor 22
Synonyms
MMRRC Submission 038564-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0358 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location31706867-31713947 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31709982 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 47 (N47S)
Ref Sequence ENSEMBL: ENSMUSP00000056125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000057783] [ENSMUST00000174480] [ENSMUST00000176710]
Predicted Effect probably benign
Transcript: ENSMUST00000036862
SMART Domains Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:COG5 35 158 3.8e-37 PFAM
Pfam:Vps51 37 120 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057783
AA Change: N47S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056125
Gene: ENSMUSG00000044067
AA Change: N47S

DomainStartEndE-ValueType
low complexity region 58 64 N/A INTRINSIC
Pfam:7tm_1 95 403 2.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174480
AA Change: N10S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134674
Gene: ENSMUSG00000044067
AA Change: N10S

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 186 3.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176710
AA Change: N10S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134839
Gene: ENSMUSG00000044067
AA Change: N10S

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
Pfam:7tm_1 58 366 1.4e-26 PFAM
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 88.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased response to aortic banding including decreased fractional shortening and decompensated heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G A 17: 79,628,156 probably benign Het
4932431P20Rik A T 7: 29,532,211 noncoding transcript Het
Abca16 A T 7: 120,544,716 K1651N probably benign Het
Abcb1b T C 5: 8,821,423 S326P probably benign Het
Ache A G 5: 137,290,373 T114A probably benign Het
Akap3 T A 6: 126,866,812 V798D probably damaging Het
Ankle1 A G 8: 71,407,545 T256A probably damaging Het
Aqp4 T C 18: 15,398,245 N153S probably benign Het
Arhgap23 G A 11: 97,463,588 V265M probably damaging Het
Arhgef25 A T 10: 127,184,453 M326K probably damaging Het
Atp6v1c2 T C 12: 17,284,960 probably benign Het
Cars A T 7: 143,588,482 probably benign Het
Cep83 A T 10: 94,719,731 M96L probably benign Het
Cfap46 A G 7: 139,651,533 probably benign Het
Cnnm3 T A 1: 36,521,222 S608T probably damaging Het
Cul7 G A 17: 46,663,744 probably null Het
Dhrs2 G A 14: 55,236,117 V78M probably damaging Het
Dhx38 A T 8: 109,552,462 D1051E probably benign Het
Eftud2 A G 11: 102,864,801 probably benign Het
Egln3 T C 12: 54,203,296 E89G possibly damaging Het
Eif2ak4 A G 2: 118,463,929 probably null Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Fsip2 A T 2: 82,983,333 N3332I possibly damaging Het
Gbp2b A T 3: 142,606,789 E311V probably damaging Het
Gcnt2 G T 13: 40,860,853 A167S probably damaging Het
Gm9797 A T 10: 11,609,344 noncoding transcript Het
Gpatch3 A G 4: 133,577,904 probably null Het
Il18rap A T 1: 40,549,042 H600L possibly damaging Het
Larp7 A G 3: 127,547,088 probably null Het
Mep1a A G 17: 43,478,950 Y490H possibly damaging Het
Mrgprh T A 17: 12,877,350 V159D probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nrbp1 T A 5: 31,244,887 I64N probably damaging Het
Nup214 G A 2: 32,004,300 probably null Het
Olfr1394 T A 11: 49,160,244 C77S probably benign Het
Olfr149 A G 9: 39,702,001 I256T possibly damaging Het
Olfr532 G T 7: 140,418,943 L277M probably damaging Het
Olfr725 A T 14: 50,035,286 L39Q probably damaging Het
Pef1 A G 4: 130,127,387 T245A probably damaging Het
Phrf1 A G 7: 141,258,304 probably benign Het
Ppig A G 2: 69,743,598 probably benign Het
Ppp1r8 G T 4: 132,834,728 F60L probably damaging Het
Psmd11 G A 11: 80,462,684 probably benign Het
Ptk6 G T 2: 181,198,522 H230Q probably benign Het
Ptprd T C 4: 75,944,989 Y1496C probably damaging Het
Rhbdl3 G T 11: 80,353,631 W388L probably damaging Het
Rnf130 T A 11: 50,071,282 M185K probably benign Het
S100a13 A T 3: 90,515,992 I97F probably damaging Het
Slc22a16 T G 10: 40,587,492 probably null Het
Tcte1 A T 17: 45,535,285 T272S probably benign Het
Terf1 T C 1: 15,805,838 V54A possibly damaging Het
Tmem63a T A 1: 180,956,423 N189K probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Trim66 G A 7: 109,460,176 Q954* probably null Het
Trpv4 A G 5: 114,630,432 F525S probably damaging Het
Ttll7 A G 3: 146,944,116 T634A probably benign Het
Ush2a T G 1: 188,537,780 N1741K possibly damaging Het
Zcchc6 T C 13: 59,782,104 D47G probably damaging Het
Zfp451 T A 1: 33,777,729 H163L probably damaging Het
Other mutations in Gpr22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Gpr22 APN 12 31708710 unclassified probably benign
IGL01521:Gpr22 APN 12 31708710 unclassified probably benign
IGL01533:Gpr22 APN 12 31708710 unclassified probably benign
IGL01585:Gpr22 APN 12 31709337 missense probably benign 0.23
IGL01601:Gpr22 APN 12 31710045 splice site probably benign
IGL01608:Gpr22 APN 12 31708780 nonsense probably null
IGL02307:Gpr22 APN 12 31708740 missense possibly damaging 0.95
IGL02440:Gpr22 APN 12 31709140 missense probably damaging 0.99
IGL02863:Gpr22 APN 12 31710007 missense probably benign 0.36
IGL03163:Gpr22 APN 12 31709172 missense possibly damaging 0.68
R0078:Gpr22 UTSW 12 31711641 missense probably benign
R0395:Gpr22 UTSW 12 31709462 missense possibly damaging 0.48
R0452:Gpr22 UTSW 12 31708794 missense possibly damaging 0.69
R0729:Gpr22 UTSW 12 31709313 missense probably damaging 1.00
R1295:Gpr22 UTSW 12 31709514 missense probably benign 0.01
R1991:Gpr22 UTSW 12 31709203 missense probably benign
R4201:Gpr22 UTSW 12 31708913 nonsense probably null
R5203:Gpr22 UTSW 12 31709788 missense probably damaging 1.00
R5505:Gpr22 UTSW 12 31709725 missense probably damaging 1.00
R5541:Gpr22 UTSW 12 31709349 missense probably damaging 0.97
R6218:Gpr22 UTSW 12 31711617 nonsense probably null
R6844:Gpr22 UTSW 12 31709952 missense probably benign
R7448:Gpr22 UTSW 12 31709515 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAGTGTTACTCTCCAGTGAGAGC -3'
(R):5'- AAACAAGGTAGCCCTGATGTTTCCC -3'

Sequencing Primer
(F):5'- TAGTTAGAGGAATGCATCCCAC -3'
(R):5'- CCCAATTCTACATTTTGAATCAGCAG -3'
Posted On2013-04-24