Mutagenetix > Incidental Mutations

Incidental Mutation 'R0358:Gpr22'

29956

Institutional Source

Beutler Lab

Gene Symbol

Gpr22

Ensembl Gene

ENSMUSG00000044067

Gene Name

G protein-coupled receptor 22

Synonyms

MMRRC Submission

038564-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0358 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31706867-31713947 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31709982 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 47 (N47S)

Ref Sequence

ENSEMBL: ENSMUSP00000056125 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036862] [ENSMUST00000057783] [ENSMUST00000174480] [ENSMUST00000176710]

Predicted Effect

probably benign
Transcript: ENSMUST00000036862

SMART Domains

Protein: ENSMUSP00000044797
Gene: ENSMUSG00000035933

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
Pfam:COG5	35	158	3.8e-37	PFAM
Pfam:Vps51	37	120	1.8e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000057783
AA Change: N47S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000056125
Gene: ENSMUSG00000044067
AA Change: N47S

Domain	Start	End	E-Value	Type
low complexity region	58	64	N/A	INTRINSIC
Pfam:7tm_1	95	403	2.3e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174480
AA Change: N10S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000134674
Gene: ENSMUSG00000044067
AA Change: N10S

Domain	Start	End	E-Value	Type
low complexity region	21	27	N/A	INTRINSIC
Pfam:7tm_1	58	186	3.3e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176710
AA Change: N10S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000134839
Gene: ENSMUSG00000044067
AA Change: N10S

Domain	Start	End	E-Value	Type
low complexity region	21	27	N/A	INTRINSIC
Pfam:7tm_1	58	366	1.4e-26	PFAM

Meta Mutation Damage Score

0.0600

Coding Region Coverage

1x: 99.0%
3x: 97.9%
10x: 95.2%
20x: 88.5%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased response to aortic banding including decreased fractional shortening and decompensated heart failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921513D11Rik	G	A	17: 79,628,156		probably benign	Het
4932431P20Rik	A	T	7: 29,532,211		noncoding transcript	Het
Abca16	A	T	7: 120,544,716	K1651N	probably benign	Het
Abcb1b	T	C	5: 8,821,423	S326P	probably benign	Het
Ache	A	G	5: 137,290,373	T114A	probably benign	Het
Akap3	T	A	6: 126,866,812	V798D	probably damaging	Het
Ankle1	A	G	8: 71,407,545	T256A	probably damaging	Het
Aqp4	T	C	18: 15,398,245	N153S	probably benign	Het
Arhgap23	G	A	11: 97,463,588	V265M	probably damaging	Het
Arhgef25	A	T	10: 127,184,453	M326K	probably damaging	Het
Atp6v1c2	T	C	12: 17,284,960		probably benign	Het
Cars	A	T	7: 143,588,482		probably benign	Het
Cep83	A	T	10: 94,719,731	M96L	probably benign	Het
Cfap46	A	G	7: 139,651,533		probably benign	Het
Cnnm3	T	A	1: 36,521,222	S608T	probably damaging	Het
Cul7	G	A	17: 46,663,744		probably null	Het
Dhrs2	G	A	14: 55,236,117	V78M	probably damaging	Het
Dhx38	A	T	8: 109,552,462	D1051E	probably benign	Het
Eftud2	A	G	11: 102,864,801		probably benign	Het
Egln3	T	C	12: 54,203,296	E89G	possibly damaging	Het
Eif2ak4	A	G	2: 118,463,929		probably null	Het
Fbxl17	G	A	17: 63,356,851	R67C	probably damaging	Het
Fsip2	A	T	2: 82,983,333	N3332I	possibly damaging	Het
Gbp2b	A	T	3: 142,606,789	E311V	probably damaging	Het
Gcnt2	G	T	13: 40,860,853	A167S	probably damaging	Het
Gm9797	A	T	10: 11,609,344		noncoding transcript	Het
Gpatch3	A	G	4: 133,577,904		probably null	Het
Il18rap	A	T	1: 40,549,042	H600L	possibly damaging	Het
Larp7	A	G	3: 127,547,088		probably null	Het
Mep1a	A	G	17: 43,478,950	Y490H	possibly damaging	Het
Mrgprh	T	A	17: 12,877,350	V159D	probably damaging	Het
Mylk	G	C	16: 34,879,475	E403Q	possibly damaging	Het
Nrbp1	T	A	5: 31,244,887	I64N	probably damaging	Het
Nup214	G	A	2: 32,004,300		probably null	Het
Olfr1394	T	A	11: 49,160,244	C77S	probably benign	Het
Olfr149	A	G	9: 39,702,001	I256T	possibly damaging	Het
Olfr532	G	T	7: 140,418,943	L277M	probably damaging	Het
Olfr725	A	T	14: 50,035,286	L39Q	probably damaging	Het
Pef1	A	G	4: 130,127,387	T245A	probably damaging	Het
Phrf1	A	G	7: 141,258,304		probably benign	Het
Ppig	A	G	2: 69,743,598		probably benign	Het
Ppp1r8	G	T	4: 132,834,728	F60L	probably damaging	Het
Psmd11	G	A	11: 80,462,684		probably benign	Het
Ptk6	G	T	2: 181,198,522	H230Q	probably benign	Het
Ptprd	T	C	4: 75,944,989	Y1496C	probably damaging	Het
Rhbdl3	G	T	11: 80,353,631	W388L	probably damaging	Het
Rnf130	T	A	11: 50,071,282	M185K	probably benign	Het
S100a13	A	T	3: 90,515,992	I97F	probably damaging	Het
Slc22a16	T	G	10: 40,587,492		probably null	Het
Tcte1	A	T	17: 45,535,285	T272S	probably benign	Het
Terf1	T	C	1: 15,805,838	V54A	possibly damaging	Het
Tmem63a	T	A	1: 180,956,423	N189K	probably benign	Het
Trim32	G	A	4: 65,613,254	R16Q	probably damaging	Het
Trim66	G	A	7: 109,460,176	Q954*	probably null	Het
Trpv4	A	G	5: 114,630,432	F525S	probably damaging	Het
Ttll7	A	G	3: 146,944,116	T634A	probably benign	Het
Ush2a	T	G	1: 188,537,780	N1741K	possibly damaging	Het
Zcchc6	T	C	13: 59,782,104	D47G	probably damaging	Het
Zfp451	T	A	1: 33,777,729	H163L	probably damaging	Het

Other mutations in Gpr22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01517:Gpr22	APN	12	31708710	unclassified	probably benign
IGL01521:Gpr22	APN	12	31708710	unclassified	probably benign
IGL01533:Gpr22	APN	12	31708710	unclassified	probably benign
IGL01585:Gpr22	APN	12	31709337	missense	probably benign	0.23
IGL01601:Gpr22	APN	12	31710045	splice site	probably benign
IGL01608:Gpr22	APN	12	31708780	nonsense	probably null
IGL02307:Gpr22	APN	12	31708740	missense	possibly damaging	0.95
IGL02440:Gpr22	APN	12	31709140	missense	probably damaging	0.99
IGL02863:Gpr22	APN	12	31710007	missense	probably benign	0.36
IGL03163:Gpr22	APN	12	31709172	missense	possibly damaging	0.68
R0078:Gpr22	UTSW	12	31711641	missense	probably benign
R0395:Gpr22	UTSW	12	31709462	missense	possibly damaging	0.48
R0452:Gpr22	UTSW	12	31708794	missense	possibly damaging	0.69
R0729:Gpr22	UTSW	12	31709313	missense	probably damaging	1.00
R1295:Gpr22	UTSW	12	31709514	missense	probably benign	0.01
R1991:Gpr22	UTSW	12	31709203	missense	probably benign
R4201:Gpr22	UTSW	12	31708913	nonsense	probably null
R5203:Gpr22	UTSW	12	31709788	missense	probably damaging	1.00
R5505:Gpr22	UTSW	12	31709725	missense	probably damaging	1.00
R5541:Gpr22	UTSW	12	31709349	missense	probably damaging	0.97
R6218:Gpr22	UTSW	12	31711617	nonsense	probably null
R6844:Gpr22	UTSW	12	31709952	missense	probably benign
R7448:Gpr22	UTSW	12	31709515	missense	probably benign	0.06
R7956:Gpr22	UTSW	12	31709220	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- GCAGTGTTACTCTCCAGTGAGAGC -3'
(R):5'- AAACAAGGTAGCCCTGATGTTTCCC -3'

Sequencing Primer
(F):5'- TAGTTAGAGGAATGCATCCCAC -3'
(R):5'- CCCAATTCTACATTTTGAATCAGCAG -3'

Posted On

2013-04-24