Incidental Mutation 'R0359:Cfap65'
ID 29969
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 038565-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R0359 (G1)
Quality Score 202
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74959760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 797 (M797L)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: M797L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: M797L

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,181 (GRCm39) Y255* probably null Het
2310003L06Rik A T 5: 88,112,455 (GRCm39) probably benign Het
Abcb5 A G 12: 118,904,067 (GRCm39) S213P probably damaging Het
Agpat1 A G 17: 34,829,551 (GRCm39) I42V probably benign Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
BB014433 G T 8: 15,092,540 (GRCm39) C104* probably null Het
Bsn C T 9: 107,989,045 (GRCm39) G2236S possibly damaging Het
Casp9 A G 4: 141,521,221 (GRCm39) E19G probably damaging Het
Ces1g T C 8: 94,055,163 (GRCm39) probably benign Het
Col14a1 A G 15: 55,271,264 (GRCm39) probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col27a1 G T 4: 63,232,964 (GRCm39) probably null Het
Col6a4 T A 9: 105,874,345 (GRCm39) H2214L probably benign Het
Ctu2 T G 8: 123,204,932 (GRCm39) S72R probably damaging Het
Cyp24a1 T A 2: 170,333,619 (GRCm39) M245L possibly damaging Het
Dgkb T A 12: 38,266,030 (GRCm39) V503E probably benign Het
Diaph3 T C 14: 87,206,938 (GRCm39) R501G probably benign Het
Dip2b A G 15: 100,109,874 (GRCm39) D1453G probably damaging Het
Dnah2 G A 11: 69,420,357 (GRCm39) T119M probably benign Het
F5 T G 1: 164,007,018 (GRCm39) V274G probably damaging Het
Farp1 A T 14: 121,492,808 (GRCm39) probably benign Het
Fcsk T C 8: 111,619,891 (GRCm39) probably null Het
Foxf1 T C 8: 121,811,742 (GRCm39) V202A possibly damaging Het
Fras1 G A 5: 96,910,449 (GRCm39) V3293I probably damaging Het
Furin C T 7: 80,041,032 (GRCm39) G602D probably damaging Het
Gclm T C 3: 122,049,269 (GRCm39) probably benign Het
Gemin4 G A 11: 76,102,988 (GRCm39) T591M probably benign Het
Glrx3 T C 7: 137,055,214 (GRCm39) S119P possibly damaging Het
Gm16485 G T 9: 8,972,437 (GRCm39) probably benign Het
Helq T C 5: 100,938,066 (GRCm39) N460S probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Kpna2 A G 11: 106,882,148 (GRCm39) L226S probably damaging Het
Myom3 G A 4: 135,505,454 (GRCm39) V448M probably damaging Het
Nalcn A G 14: 123,536,580 (GRCm39) S1224P probably damaging Het
Or52n2 A T 7: 104,542,521 (GRCm39) F105I probably damaging Het
Or56b1b C T 7: 108,164,721 (GRCm39) D94N probably benign Het
Or7a38 A G 10: 78,753,177 (GRCm39) T168A probably benign Het
Plag1 C T 4: 3,904,546 (GRCm39) C215Y probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Pot1a G A 6: 25,771,679 (GRCm39) probably benign Het
Ppfia1 T C 7: 144,038,929 (GRCm39) D494G probably damaging Het
Ppp1r1a T A 15: 103,441,915 (GRCm39) D51V probably damaging Het
Ptprz1 T A 6: 22,973,175 (GRCm39) probably benign Het
Rad51ap1 A T 6: 126,911,704 (GRCm39) V61D probably damaging Het
Reln G A 5: 22,253,798 (GRCm39) L605F probably damaging Het
Riok3 T C 18: 12,282,006 (GRCm39) I325T probably damaging Het
Sclt1 A T 3: 41,616,005 (GRCm39) probably null Het
Slc25a39 A G 11: 102,297,395 (GRCm39) V24A possibly damaging Het
Slc9a3 T G 13: 74,305,726 (GRCm39) S248A probably damaging Het
Slco6d1 T A 1: 98,394,422 (GRCm39) C369S probably benign Het
Spen T C 4: 141,244,181 (GRCm39) S285G unknown Het
Stxbp5l A G 16: 37,036,440 (GRCm39) probably benign Het
Thsd7a G A 6: 12,352,030 (GRCm39) P1055L probably damaging Het
Tmed3 C T 9: 89,581,842 (GRCm39) S207N possibly damaging Het
Trerf1 G T 17: 47,652,062 (GRCm39) noncoding transcript Het
Triml1 A T 8: 43,583,542 (GRCm39) V353E probably damaging Het
Ttn G A 2: 76,549,401 (GRCm39) R31759C probably damaging Het
Ugt2b37 T C 5: 87,398,443 (GRCm39) Q331R probably benign Het
Urb1 A G 16: 90,588,048 (GRCm39) I420T probably damaging Het
Vmn1r68 A T 7: 10,261,201 (GRCm39) L299Q probably damaging Het
Vmn1r81 T A 7: 11,993,877 (GRCm39) T244S probably damaging Het
Vps13a A G 19: 16,618,941 (GRCm39) F2875S probably damaging Het
Wscd1 A G 11: 71,657,692 (GRCm39) M166V probably damaging Het
Zfp296 T C 7: 19,313,864 (GRCm39) Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 (GRCm39) H737R probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAGATTGCTCAGGCAGGTGTG -3'
(R):5'- TTCAGTCTGGAAGACAGCTTTGGC -3'

Sequencing Primer
(F):5'- CACTCACGAGGTTCTCGTTAGG -3'
(R):5'- ACAGCTTTGGCTGTCTCC -3'
Posted On 2013-04-24