Incidental Mutation 'R0359:Rad51ap1'
ID29990
Institutional Source Beutler Lab
Gene Symbol Rad51ap1
Ensembl Gene ENSMUSG00000030346
Gene NameRAD51 associated protein 1
SynonymsRAB22, 2510006L10Rik
MMRRC Submission 038565-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0359 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location126923050-126939587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126934741 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 61 (V61D)
Ref Sequence ENSEMBL: ENSMUSP00000122978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112220] [ENSMUST00000112221] [ENSMUST00000144954] [ENSMUST00000202897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112220
AA Change: V61D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107839
Gene: ENSMUSG00000030346
AA Change: V61D

DomainStartEndE-ValueType
low complexity region 179 204 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112221
AA Change: V61D

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107841
Gene: ENSMUSG00000030346
AA Change: V61D

DomainStartEndE-ValueType
low complexity region 180 205 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
Pfam:RAD51_interact 293 331 1.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141212
Predicted Effect probably damaging
Transcript: ENSMUST00000144954
AA Change: V61D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122978
Gene: ENSMUSG00000030346
AA Change: V61D

DomainStartEndE-ValueType
low complexity region 121 146 N/A INTRINSIC
low complexity region 153 163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202835
Predicted Effect possibly damaging
Transcript: ENSMUST00000202897
AA Change: V61D

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
2310003L06Rik A T 5: 87,964,596 probably benign Het
Abcb5 A G 12: 118,940,332 S213P probably damaging Het
Agpat1 A G 17: 34,610,577 I42V probably benign Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
BB014433 G T 8: 15,042,540 C104* probably null Het
Bsn C T 9: 108,111,846 G2236S possibly damaging Het
Casp9 A G 4: 141,793,910 E19G probably damaging Het
Ces1g T C 8: 93,328,535 probably benign Het
Cfap65 T A 1: 74,920,601 M797L probably benign Het
Col14a1 A G 15: 55,407,868 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col27a1 G T 4: 63,314,727 probably null Het
Col6a4 T A 9: 105,997,146 H2214L probably benign Het
Ctu2 T G 8: 122,478,193 S72R probably damaging Het
Cyp24a1 T A 2: 170,491,699 M245L possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Diaph3 T C 14: 86,969,502 R501G probably benign Het
Dip2b A G 15: 100,211,993 D1453G probably damaging Het
Dnah2 G A 11: 69,529,531 T119M probably benign Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Farp1 A T 14: 121,255,396 probably benign Het
Foxf1 T C 8: 121,085,003 V202A possibly damaging Het
Fras1 G A 5: 96,762,590 V3293I probably damaging Het
Fuk T C 8: 110,893,259 probably null Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Gclm T C 3: 122,255,620 probably benign Het
Gemin4 G A 11: 76,212,162 T591M probably benign Het
Glrx3 T C 7: 137,453,485 S119P possibly damaging Het
Gm16485 G T 9: 8,972,436 probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Kpna2 A G 11: 106,991,322 L226S probably damaging Het
Myom3 G A 4: 135,778,143 V448M probably damaging Het
Nalcn A G 14: 123,299,168 S1224P probably damaging Het
Olfr1354 A G 10: 78,917,343 T168A probably benign Het
Olfr504 C T 7: 108,565,514 D94N probably benign Het
Olfr666 A T 7: 104,893,314 F105I probably damaging Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pot1a G A 6: 25,771,680 probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ppp1r1a T A 15: 103,533,488 D51V probably damaging Het
Ptprz1 T A 6: 22,973,176 probably benign Het
Reln G A 5: 22,048,800 L605F probably damaging Het
Riok3 T C 18: 12,148,949 I325T probably damaging Het
Sclt1 A T 3: 41,661,570 probably null Het
Slc25a39 A G 11: 102,406,569 V24A possibly damaging Het
Slc9a3 T G 13: 74,157,607 S248A probably damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Spen T C 4: 141,516,870 S285G unknown Het
Stxbp5l A G 16: 37,216,078 probably benign Het
Thsd7a G A 6: 12,352,031 P1055L probably damaging Het
Tmed3 C T 9: 89,699,789 S207N possibly damaging Het
Trerf1 G T 17: 47,341,136 noncoding transcript Het
Triml1 A T 8: 43,130,505 V353E probably damaging Het
Ttn G A 2: 76,719,057 R31759C probably damaging Het
Ugt2b37 T C 5: 87,250,584 Q331R probably benign Het
Urb1 A G 16: 90,791,160 I420T probably damaging Het
Vmn1r68 A T 7: 10,527,274 L299Q probably damaging Het
Vmn1r81 T A 7: 12,259,950 T244S probably damaging Het
Vps13a A G 19: 16,641,577 F2875S probably damaging Het
Wscd1 A G 11: 71,766,866 M166V probably damaging Het
Zfp296 T C 7: 19,579,939 Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Other mutations in Rad51ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Rad51ap1 APN 6 126928160 missense probably damaging 1.00
IGL02371:Rad51ap1 APN 6 126927564 missense probably benign 0.14
IGL02398:Rad51ap1 APN 6 126928151 missense probably damaging 1.00
R0265:Rad51ap1 UTSW 6 126924197 makesense probably null
R0488:Rad51ap1 UTSW 6 126934760 missense possibly damaging 0.94
R1527:Rad51ap1 UTSW 6 126928167 splice site probably null
R3018:Rad51ap1 UTSW 6 126939522 start gained probably null
R4464:Rad51ap1 UTSW 6 126934768 missense possibly damaging 0.94
R4691:Rad51ap1 UTSW 6 126927553 missense probably benign
R5314:Rad51ap1 UTSW 6 126928158 missense probably damaging 1.00
R5469:Rad51ap1 UTSW 6 126928227 missense probably damaging 0.96
R7177:Rad51ap1 UTSW 6 126925020 missense probably benign 0.08
R8026:Rad51ap1 UTSW 6 126934712 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGAAAGCACTTGATGGCACCTC -3'
(R):5'- ACATGCTGGGCTACACTGTGAAG -3'

Sequencing Primer
(F):5'- CCCCGTGCTCCAGACAG -3'
(R):5'- CCAGTGTTCATCATCAGTGAGAC -3'
Posted On2013-04-24