Incidental Mutation 'R0359:Glrx3'
ID29997
Institutional Source Beutler Lab
Gene Symbol Glrx3
Ensembl Gene ENSMUSG00000031068
Gene Nameglutaredoxin 3
SynonymsPKC interacting cousin of thioredoxin, Txnl2, PICOT
MMRRC Submission 038565-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0359 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location137437614-137468594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137453485 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 119 (S119P)
Ref Sequence ENSEMBL: ENSMUSP00000066621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064404] [ENSMUST00000209696] [ENSMUST00000211496] [ENSMUST00000211769]
PDB Structure
Solution Structure of the PICOT homology 2 domain of the mouse PKC-interacting cousin of thioredoxin protein [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064404
AA Change: S119P

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066621
Gene: ENSMUSG00000031068
AA Change: S119P

DomainStartEndE-ValueType
Pfam:Phosducin 6 102 6.3e-10 PFAM
Pfam:DIM1 13 112 4.5e-9 PFAM
Pfam:Thioredoxin 15 117 1.2e-21 PFAM
Pfam:Glutaredoxin 148 212 2.9e-19 PFAM
Pfam:Glutaredoxin 250 314 1.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209696
Predicted Effect probably benign
Transcript: ENSMUST00000211496
AA Change: S119P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000211769
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality during late organogenesis and early fetal development. Mice heterozygous for this gene trapped allele exhibit increased response to cardiac injury and decreased cardiac muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
2310003L06Rik A T 5: 87,964,596 probably benign Het
Abcb5 A G 12: 118,940,332 S213P probably damaging Het
Agpat1 A G 17: 34,610,577 I42V probably benign Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
BB014433 G T 8: 15,042,540 C104* probably null Het
Bsn C T 9: 108,111,846 G2236S possibly damaging Het
Casp9 A G 4: 141,793,910 E19G probably damaging Het
Ces1g T C 8: 93,328,535 probably benign Het
Cfap65 T A 1: 74,920,601 M797L probably benign Het
Col14a1 A G 15: 55,407,868 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col27a1 G T 4: 63,314,727 probably null Het
Col6a4 T A 9: 105,997,146 H2214L probably benign Het
Ctu2 T G 8: 122,478,193 S72R probably damaging Het
Cyp24a1 T A 2: 170,491,699 M245L possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Diaph3 T C 14: 86,969,502 R501G probably benign Het
Dip2b A G 15: 100,211,993 D1453G probably damaging Het
Dnah2 G A 11: 69,529,531 T119M probably benign Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Farp1 A T 14: 121,255,396 probably benign Het
Foxf1 T C 8: 121,085,003 V202A possibly damaging Het
Fras1 G A 5: 96,762,590 V3293I probably damaging Het
Fuk T C 8: 110,893,259 probably null Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Gclm T C 3: 122,255,620 probably benign Het
Gemin4 G A 11: 76,212,162 T591M probably benign Het
Gm16485 G T 9: 8,972,436 probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Kpna2 A G 11: 106,991,322 L226S probably damaging Het
Myom3 G A 4: 135,778,143 V448M probably damaging Het
Nalcn A G 14: 123,299,168 S1224P probably damaging Het
Olfr1354 A G 10: 78,917,343 T168A probably benign Het
Olfr504 C T 7: 108,565,514 D94N probably benign Het
Olfr666 A T 7: 104,893,314 F105I probably damaging Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pot1a G A 6: 25,771,680 probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ppp1r1a T A 15: 103,533,488 D51V probably damaging Het
Ptprz1 T A 6: 22,973,176 probably benign Het
Rad51ap1 A T 6: 126,934,741 V61D probably damaging Het
Reln G A 5: 22,048,800 L605F probably damaging Het
Riok3 T C 18: 12,148,949 I325T probably damaging Het
Sclt1 A T 3: 41,661,570 probably null Het
Slc25a39 A G 11: 102,406,569 V24A possibly damaging Het
Slc9a3 T G 13: 74,157,607 S248A probably damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Spen T C 4: 141,516,870 S285G unknown Het
Stxbp5l A G 16: 37,216,078 probably benign Het
Thsd7a G A 6: 12,352,031 P1055L probably damaging Het
Tmed3 C T 9: 89,699,789 S207N possibly damaging Het
Trerf1 G T 17: 47,341,136 noncoding transcript Het
Triml1 A T 8: 43,130,505 V353E probably damaging Het
Ttn G A 2: 76,719,057 R31759C probably damaging Het
Ugt2b37 T C 5: 87,250,584 Q331R probably benign Het
Urb1 A G 16: 90,791,160 I420T probably damaging Het
Vmn1r68 A T 7: 10,527,274 L299Q probably damaging Het
Vmn1r81 T A 7: 12,259,950 T244S probably damaging Het
Vps13a A G 19: 16,641,577 F2875S probably damaging Het
Wscd1 A G 11: 71,766,866 M166V probably damaging Het
Zfp296 T C 7: 19,579,939 Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Other mutations in Glrx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Glrx3 APN 7 137452713 missense probably damaging 1.00
IGL02435:Glrx3 APN 7 137461396 missense possibly damaging 0.61
F5770:Glrx3 UTSW 7 137459153 missense probably benign
R0347:Glrx3 UTSW 7 137437701 missense unknown
R1270:Glrx3 UTSW 7 137453414 missense probably benign 0.02
R3692:Glrx3 UTSW 7 137459117 splice site probably benign
R4909:Glrx3 UTSW 7 137445036 missense probably damaging 1.00
R4920:Glrx3 UTSW 7 137464130 missense probably null 1.00
R5509:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R6831:Glrx3 UTSW 7 137459222 missense possibly damaging 0.76
R7200:Glrx3 UTSW 7 137464436 missense possibly damaging 0.81
R7347:Glrx3 UTSW 7 137459286 missense possibly damaging 0.83
R7356:Glrx3 UTSW 7 137452724 missense probably damaging 0.98
R7481:Glrx3 UTSW 7 137445022 missense probably damaging 1.00
R7660:Glrx3 UTSW 7 137459225 missense probably damaging 1.00
R7685:Glrx3 UTSW 7 137459191 missense probably damaging 0.98
R8147:Glrx3 UTSW 7 137463007 missense probably benign 0.00
V7581:Glrx3 UTSW 7 137459153 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCACCCACGGGTATTATTACCAC -3'
(R):5'- CATCAGGATCGGCTTCTTACCACAG -3'

Sequencing Primer
(F):5'- GCTCACAGGGATGCCTTTAAAATG -3'
(R):5'- ACCACAGCGTGGTTCTTG -3'
Posted On2013-04-24