Incidental Mutation 'R0359:Olfr1354'
ID30007
Institutional Source Beutler Lab
Gene Symbol Olfr1354
Ensembl Gene ENSMUSG00000094673
Gene Nameolfactory receptor 1354
SynonymsGA_x6K02T2QGN0-2895081-2894349, EG257869, MOR139-5, MOR185-8, MOR139-7, GA_x6K02T03FR9-4826-3919, Olfr233-ps1
MMRRC Submission 038565-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R0359 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78913171-78920399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78917343 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 168 (T168A)
Ref Sequence ENSEMBL: ENSMUSP00000150374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075859] [ENSMUST00000204587] [ENSMUST00000217073]
Predicted Effect probably benign
Transcript: ENSMUST00000075859
AA Change: T168A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093126
Gene: ENSMUSG00000094673
AA Change: T168A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203132
AA Change: T168A
SMART Domains Protein: ENSMUSP00000144897
Gene: ENSMUSG00000094673
AA Change: T168A

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 2.4e-49 PFAM
Pfam:7tm_1 42 291 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204587
AA Change: T168A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205040
SMART Domains Protein: ENSMUSP00000144994
Gene: ENSMUSG00000094673

DomainStartEndE-ValueType
Pfam:7tm_4 32 146 9.6e-24 PFAM
Pfam:7TM_GPCR_Srsx 36 147 1.8e-6 PFAM
Pfam:7tm_1 42 147 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217073
AA Change: T168A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
2310003L06Rik A T 5: 87,964,596 probably benign Het
Abcb5 A G 12: 118,940,332 S213P probably damaging Het
Agpat1 A G 17: 34,610,577 I42V probably benign Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
BB014433 G T 8: 15,042,540 C104* probably null Het
Bsn C T 9: 108,111,846 G2236S possibly damaging Het
Casp9 A G 4: 141,793,910 E19G probably damaging Het
Ces1g T C 8: 93,328,535 probably benign Het
Cfap65 T A 1: 74,920,601 M797L probably benign Het
Col14a1 A G 15: 55,407,868 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col27a1 G T 4: 63,314,727 probably null Het
Col6a4 T A 9: 105,997,146 H2214L probably benign Het
Ctu2 T G 8: 122,478,193 S72R probably damaging Het
Cyp24a1 T A 2: 170,491,699 M245L possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Diaph3 T C 14: 86,969,502 R501G probably benign Het
Dip2b A G 15: 100,211,993 D1453G probably damaging Het
Dnah2 G A 11: 69,529,531 T119M probably benign Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Farp1 A T 14: 121,255,396 probably benign Het
Foxf1 T C 8: 121,085,003 V202A possibly damaging Het
Fras1 G A 5: 96,762,590 V3293I probably damaging Het
Fuk T C 8: 110,893,259 probably null Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Gclm T C 3: 122,255,620 probably benign Het
Gemin4 G A 11: 76,212,162 T591M probably benign Het
Glrx3 T C 7: 137,453,485 S119P possibly damaging Het
Gm16485 G T 9: 8,972,436 probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Kpna2 A G 11: 106,991,322 L226S probably damaging Het
Myom3 G A 4: 135,778,143 V448M probably damaging Het
Nalcn A G 14: 123,299,168 S1224P probably damaging Het
Olfr504 C T 7: 108,565,514 D94N probably benign Het
Olfr666 A T 7: 104,893,314 F105I probably damaging Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pot1a G A 6: 25,771,680 probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ppp1r1a T A 15: 103,533,488 D51V probably damaging Het
Ptprz1 T A 6: 22,973,176 probably benign Het
Rad51ap1 A T 6: 126,934,741 V61D probably damaging Het
Reln G A 5: 22,048,800 L605F probably damaging Het
Riok3 T C 18: 12,148,949 I325T probably damaging Het
Sclt1 A T 3: 41,661,570 probably null Het
Slc25a39 A G 11: 102,406,569 V24A possibly damaging Het
Slc9a3 T G 13: 74,157,607 S248A probably damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Spen T C 4: 141,516,870 S285G unknown Het
Stxbp5l A G 16: 37,216,078 probably benign Het
Thsd7a G A 6: 12,352,031 P1055L probably damaging Het
Tmed3 C T 9: 89,699,789 S207N possibly damaging Het
Trerf1 G T 17: 47,341,136 noncoding transcript Het
Triml1 A T 8: 43,130,505 V353E probably damaging Het
Ttn G A 2: 76,719,057 R31759C probably damaging Het
Ugt2b37 T C 5: 87,250,584 Q331R probably benign Het
Urb1 A G 16: 90,791,160 I420T probably damaging Het
Vmn1r68 A T 7: 10,527,274 L299Q probably damaging Het
Vmn1r81 T A 7: 12,259,950 T244S probably damaging Het
Vps13a A G 19: 16,641,577 F2875S probably damaging Het
Wscd1 A G 11: 71,766,866 M166V probably damaging Het
Zfp296 T C 7: 19,579,939 Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Other mutations in Olfr1354
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02903:Olfr1354 APN 10 78917416 missense probably damaging 0.99
IGL02962:Olfr1354 APN 10 78916939 missense probably damaging 1.00
IGL03032:Olfr1354 APN 10 78917637 missense probably benign 0.21
PIT4495001:Olfr1354 UTSW 10 78916987 missense probably benign
R0268:Olfr1354 UTSW 10 78917605 missense probably damaging 0.99
R0382:Olfr1354 UTSW 10 78917126 nonsense probably null
R1895:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R1946:Olfr1354 UTSW 10 78916924 missense probably damaging 1.00
R2035:Olfr1354 UTSW 10 78917587 missense possibly damaging 0.86
R3853:Olfr1354 UTSW 10 78916947 missense probably damaging 1.00
R4756:Olfr1354 UTSW 10 78917527 missense probably damaging 0.99
R5326:Olfr1354 UTSW 10 78917586 missense possibly damaging 0.86
R5607:Olfr1354 UTSW 10 78917099 missense possibly damaging 0.93
R7070:Olfr1354 UTSW 10 78917268 missense probably benign
R7088:Olfr1354 UTSW 10 78917759 missense probably benign 0.00
R7212:Olfr1354 UTSW 10 78917505 missense possibly damaging 0.81
R7348:Olfr1354 UTSW 10 78917562 missense probably damaging 1.00
R7386:Olfr1354 UTSW 10 78916843 start codon destroyed probably null 0.98
R7847:Olfr1354 UTSW 10 78916896 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGATGGCCTATGACCGATATGTGG -3'
(R):5'- GCAACAATGGAAACTTCAGCCAGTC -3'

Sequencing Primer
(F):5'- CCTATGACCGATATGTGGCTATCTG -3'
(R):5'- CTTCCCTTGAACTGAGGAGATAG -3'
Posted On2013-04-24