Incidental Mutation 'R0359:Nalcn'
ID 30019
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms Vgcnl1, A530023G15Rik
MMRRC Submission 038565-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0359 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 123514046-123864556 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 123536580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1224 (S1224P)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000201
AA Change: S1224P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: S1224P

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Meta Mutation Damage Score 0.8161 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,181 (GRCm39) Y255* probably null Het
2310003L06Rik A T 5: 88,112,455 (GRCm39) probably benign Het
Abcb5 A G 12: 118,904,067 (GRCm39) S213P probably damaging Het
Agpat1 A G 17: 34,829,551 (GRCm39) I42V probably benign Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
BB014433 G T 8: 15,092,540 (GRCm39) C104* probably null Het
Bsn C T 9: 107,989,045 (GRCm39) G2236S possibly damaging Het
Casp9 A G 4: 141,521,221 (GRCm39) E19G probably damaging Het
Ces1g T C 8: 94,055,163 (GRCm39) probably benign Het
Cfap65 T A 1: 74,959,760 (GRCm39) M797L probably benign Het
Col14a1 A G 15: 55,271,264 (GRCm39) probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col27a1 G T 4: 63,232,964 (GRCm39) probably null Het
Col6a4 T A 9: 105,874,345 (GRCm39) H2214L probably benign Het
Ctu2 T G 8: 123,204,932 (GRCm39) S72R probably damaging Het
Cyp24a1 T A 2: 170,333,619 (GRCm39) M245L possibly damaging Het
Dgkb T A 12: 38,266,030 (GRCm39) V503E probably benign Het
Diaph3 T C 14: 87,206,938 (GRCm39) R501G probably benign Het
Dip2b A G 15: 100,109,874 (GRCm39) D1453G probably damaging Het
Dnah2 G A 11: 69,420,357 (GRCm39) T119M probably benign Het
F5 T G 1: 164,007,018 (GRCm39) V274G probably damaging Het
Farp1 A T 14: 121,492,808 (GRCm39) probably benign Het
Fcsk T C 8: 111,619,891 (GRCm39) probably null Het
Foxf1 T C 8: 121,811,742 (GRCm39) V202A possibly damaging Het
Fras1 G A 5: 96,910,449 (GRCm39) V3293I probably damaging Het
Furin C T 7: 80,041,032 (GRCm39) G602D probably damaging Het
Gclm T C 3: 122,049,269 (GRCm39) probably benign Het
Gemin4 G A 11: 76,102,988 (GRCm39) T591M probably benign Het
Glrx3 T C 7: 137,055,214 (GRCm39) S119P possibly damaging Het
Gm16485 G T 9: 8,972,437 (GRCm39) probably benign Het
Helq T C 5: 100,938,066 (GRCm39) N460S probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Kpna2 A G 11: 106,882,148 (GRCm39) L226S probably damaging Het
Myom3 G A 4: 135,505,454 (GRCm39) V448M probably damaging Het
Or52n2 A T 7: 104,542,521 (GRCm39) F105I probably damaging Het
Or56b1b C T 7: 108,164,721 (GRCm39) D94N probably benign Het
Or7a38 A G 10: 78,753,177 (GRCm39) T168A probably benign Het
Plag1 C T 4: 3,904,546 (GRCm39) C215Y probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Pot1a G A 6: 25,771,679 (GRCm39) probably benign Het
Ppfia1 T C 7: 144,038,929 (GRCm39) D494G probably damaging Het
Ppp1r1a T A 15: 103,441,915 (GRCm39) D51V probably damaging Het
Ptprz1 T A 6: 22,973,175 (GRCm39) probably benign Het
Rad51ap1 A T 6: 126,911,704 (GRCm39) V61D probably damaging Het
Reln G A 5: 22,253,798 (GRCm39) L605F probably damaging Het
Riok3 T C 18: 12,282,006 (GRCm39) I325T probably damaging Het
Sclt1 A T 3: 41,616,005 (GRCm39) probably null Het
Slc25a39 A G 11: 102,297,395 (GRCm39) V24A possibly damaging Het
Slc9a3 T G 13: 74,305,726 (GRCm39) S248A probably damaging Het
Slco6d1 T A 1: 98,394,422 (GRCm39) C369S probably benign Het
Spen T C 4: 141,244,181 (GRCm39) S285G unknown Het
Stxbp5l A G 16: 37,036,440 (GRCm39) probably benign Het
Thsd7a G A 6: 12,352,030 (GRCm39) P1055L probably damaging Het
Tmed3 C T 9: 89,581,842 (GRCm39) S207N possibly damaging Het
Trerf1 G T 17: 47,652,062 (GRCm39) noncoding transcript Het
Triml1 A T 8: 43,583,542 (GRCm39) V353E probably damaging Het
Ttn G A 2: 76,549,401 (GRCm39) R31759C probably damaging Het
Ugt2b37 T C 5: 87,398,443 (GRCm39) Q331R probably benign Het
Urb1 A G 16: 90,588,048 (GRCm39) I420T probably damaging Het
Vmn1r68 A T 7: 10,261,201 (GRCm39) L299Q probably damaging Het
Vmn1r81 T A 7: 11,993,877 (GRCm39) T244S probably damaging Het
Vps13a A G 19: 16,618,941 (GRCm39) F2875S probably damaging Het
Wscd1 A G 11: 71,657,692 (GRCm39) M166V probably damaging Het
Zfp296 T C 7: 19,313,864 (GRCm39) Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 (GRCm39) H737R probably damaging Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123,586,201 (GRCm39) missense probably benign 0.00
IGL00964:Nalcn APN 14 123,532,796 (GRCm39) splice site probably benign
IGL01310:Nalcn APN 14 123,554,661 (GRCm39) missense probably benign 0.00
IGL01578:Nalcn APN 14 123,809,503 (GRCm39) missense probably benign 0.00
IGL01925:Nalcn APN 14 123,529,260 (GRCm39) missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123,560,770 (GRCm39) missense probably benign 0.05
IGL02096:Nalcn APN 14 123,831,915 (GRCm39) missense probably benign 0.11
IGL02212:Nalcn APN 14 123,752,742 (GRCm39) missense probably damaging 0.99
IGL02306:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02471:Nalcn APN 14 123,560,726 (GRCm39) missense probably benign 0.02
IGL02478:Nalcn APN 14 123,558,717 (GRCm39) missense probably benign 0.26
IGL02551:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02630:Nalcn APN 14 123,555,291 (GRCm39) missense probably benign 0.16
IGL02632:Nalcn APN 14 123,555,265 (GRCm39) missense probably benign 0.11
IGL02661:Nalcn APN 14 123,830,321 (GRCm39) splice site probably benign
IGL02830:Nalcn APN 14 123,530,881 (GRCm39) missense probably damaging 0.98
IGL02939:Nalcn APN 14 123,536,284 (GRCm39) missense probably null 1.00
IGL03035:Nalcn APN 14 123,515,630 (GRCm39) nonsense probably null
IGL03226:Nalcn APN 14 123,518,527 (GRCm39) missense probably benign 0.00
IGL03242:Nalcn APN 14 123,558,899 (GRCm39) missense possibly damaging 0.91
Narnia UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0019:Nalcn UTSW 14 123,744,901 (GRCm39) missense probably benign 0.18
R0144:Nalcn UTSW 14 123,647,251 (GRCm39) splice site probably benign
R0144:Nalcn UTSW 14 123,608,948 (GRCm39) missense probably damaging 0.96
R0383:Nalcn UTSW 14 123,744,971 (GRCm39) missense probably benign 0.01
R0400:Nalcn UTSW 14 123,528,372 (GRCm39) splice site probably benign
R0467:Nalcn UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0506:Nalcn UTSW 14 123,834,026 (GRCm39) missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123,531,755 (GRCm39) missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123,536,553 (GRCm39) splice site probably benign
R0624:Nalcn UTSW 14 123,607,444 (GRCm39) missense probably benign
R0883:Nalcn UTSW 14 123,702,152 (GRCm39) missense probably damaging 1.00
R1381:Nalcn UTSW 14 123,551,517 (GRCm39) missense probably damaging 1.00
R1467:Nalcn UTSW 14 123,702,068 (GRCm39) splice site probably benign
R1689:Nalcn UTSW 14 123,522,666 (GRCm39) missense probably damaging 1.00
R1726:Nalcn UTSW 14 123,545,816 (GRCm39) missense probably damaging 1.00
R1774:Nalcn UTSW 14 123,515,678 (GRCm39) missense probably benign
R1854:Nalcn UTSW 14 123,697,824 (GRCm39) missense probably damaging 1.00
R1869:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123,521,013 (GRCm39) missense probably benign 0.00
R1899:Nalcn UTSW 14 123,553,538 (GRCm39) missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123,540,181 (GRCm39) missense probably benign 0.08
R2016:Nalcn UTSW 14 123,831,993 (GRCm39) splice site probably null
R2034:Nalcn UTSW 14 123,521,015 (GRCm39) missense probably benign 0.01
R2087:Nalcn UTSW 14 123,518,557 (GRCm39) missense probably benign
R2149:Nalcn UTSW 14 123,607,429 (GRCm39) missense probably benign 0.01
R2157:Nalcn UTSW 14 123,647,164 (GRCm39) missense probably benign 0.32
R2166:Nalcn UTSW 14 123,607,363 (GRCm39) missense probably benign 0.00
R2932:Nalcn UTSW 14 123,830,430 (GRCm39) missense probably benign 0.06
R3408:Nalcn UTSW 14 123,834,029 (GRCm39) missense probably null 0.98
R3778:Nalcn UTSW 14 123,702,128 (GRCm39) missense probably damaging 1.00
R3807:Nalcn UTSW 14 123,515,599 (GRCm39) missense probably damaging 1.00
R3835:Nalcn UTSW 14 123,530,834 (GRCm39) splice site probably benign
R3937:Nalcn UTSW 14 123,607,357 (GRCm39) missense probably benign 0.00
R4001:Nalcn UTSW 14 123,834,006 (GRCm39) missense probably damaging 1.00
R4015:Nalcn UTSW 14 123,723,799 (GRCm39) missense probably damaging 1.00
R4033:Nalcn UTSW 14 123,837,401 (GRCm39) splice site probably benign
R4231:Nalcn UTSW 14 123,837,325 (GRCm39) missense probably benign 0.01
R4464:Nalcn UTSW 14 123,560,762 (GRCm39) missense probably benign
R4512:Nalcn UTSW 14 123,532,860 (GRCm39) missense probably damaging 1.00
R4542:Nalcn UTSW 14 123,558,889 (GRCm39) synonymous silent
R4557:Nalcn UTSW 14 123,558,647 (GRCm39) intron probably benign
R4869:Nalcn UTSW 14 123,837,296 (GRCm39) missense probably benign 0.44
R5083:Nalcn UTSW 14 123,560,706 (GRCm39) splice site probably null
R5109:Nalcn UTSW 14 123,515,650 (GRCm39) missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123,753,182 (GRCm39) missense probably damaging 0.98
R5158:Nalcn UTSW 14 123,753,149 (GRCm39) missense probably damaging 1.00
R5259:Nalcn UTSW 14 123,753,063 (GRCm39) missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123,752,777 (GRCm39) missense probably damaging 1.00
R5514:Nalcn UTSW 14 123,521,123 (GRCm39) missense probably benign 0.14
R5523:Nalcn UTSW 14 123,647,155 (GRCm39) missense probably damaging 1.00
R5551:Nalcn UTSW 14 123,515,698 (GRCm39) missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5671:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5750:Nalcn UTSW 14 123,809,450 (GRCm39) missense probably benign
R5765:Nalcn UTSW 14 123,702,138 (GRCm39) missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123,647,161 (GRCm39) missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123,555,255 (GRCm39) missense probably benign 0.00
R6558:Nalcn UTSW 14 123,723,919 (GRCm39) missense probably benign
R6631:Nalcn UTSW 14 123,697,663 (GRCm39) missense probably benign 0.17
R6667:Nalcn UTSW 14 123,558,735 (GRCm39) missense probably damaging 1.00
R6670:Nalcn UTSW 14 123,702,084 (GRCm39) missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123,535,479 (GRCm39) missense probably damaging 0.99
R6731:Nalcn UTSW 14 123,837,346 (GRCm39) missense probably benign 0.22
R6957:Nalcn UTSW 14 123,744,966 (GRCm39) missense probably damaging 0.96
R6970:Nalcn UTSW 14 123,551,506 (GRCm39) missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123,530,877 (GRCm39) missense probably damaging 1.00
R7018:Nalcn UTSW 14 123,647,233 (GRCm39) missense probably damaging 1.00
R7040:Nalcn UTSW 14 123,525,267 (GRCm39) missense probably benign
R7089:Nalcn UTSW 14 123,515,761 (GRCm39) missense probably benign 0.01
R7128:Nalcn UTSW 14 123,831,914 (GRCm39) missense probably damaging 0.99
R7149:Nalcn UTSW 14 123,837,277 (GRCm39) missense probably benign 0.02
R7361:Nalcn UTSW 14 123,529,251 (GRCm39) missense probably benign 0.00
R7378:Nalcn UTSW 14 123,540,302 (GRCm39) missense probably damaging 1.00
R7408:Nalcn UTSW 14 123,529,272 (GRCm39) missense probably benign 0.00
R7470:Nalcn UTSW 14 123,809,456 (GRCm39) missense probably benign 0.09
R7483:Nalcn UTSW 14 123,551,499 (GRCm39) missense probably damaging 1.00
R7521:Nalcn UTSW 14 123,530,870 (GRCm39) missense probably damaging 1.00
R7558:Nalcn UTSW 14 123,723,797 (GRCm39) critical splice donor site probably null
R7585:Nalcn UTSW 14 123,753,050 (GRCm39) missense probably damaging 1.00
R7591:Nalcn UTSW 14 123,561,297 (GRCm39) missense probably benign 0.01
R7761:Nalcn UTSW 14 123,531,792 (GRCm39) missense probably damaging 1.00
R7761:Nalcn UTSW 14 123,531,791 (GRCm39) missense probably damaging 1.00
R7811:Nalcn UTSW 14 123,536,357 (GRCm39) missense probably damaging 1.00
R7983:Nalcn UTSW 14 123,830,409 (GRCm39) missense probably benign 0.17
R8089:Nalcn UTSW 14 123,537,372 (GRCm39) missense probably damaging 1.00
R8110:Nalcn UTSW 14 123,702,113 (GRCm39) missense probably benign 0.00
R8190:Nalcn UTSW 14 123,837,351 (GRCm39) missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123,554,436 (GRCm39) missense probably damaging 1.00
R8407:Nalcn UTSW 14 123,554,683 (GRCm39) missense probably damaging 1.00
R8497:Nalcn UTSW 14 123,752,771 (GRCm39) missense probably damaging 1.00
R8544:Nalcn UTSW 14 123,608,935 (GRCm39) missense probably benign 0.40
R8549:Nalcn UTSW 14 123,607,448 (GRCm39) missense probably benign 0.01
R8731:Nalcn UTSW 14 123,837,266 (GRCm39) missense probably benign 0.01
R8862:Nalcn UTSW 14 123,647,199 (GRCm39) missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123,561,284 (GRCm39) missense probably benign 0.00
R9072:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123,834,016 (GRCm39) missense probably damaging 1.00
R9193:Nalcn UTSW 14 123,545,792 (GRCm39) nonsense probably null
R9241:Nalcn UTSW 14 123,809,429 (GRCm39) missense probably benign 0.00
R9267:Nalcn UTSW 14 123,518,567 (GRCm39) missense probably benign 0.08
R9274:Nalcn UTSW 14 123,753,068 (GRCm39) missense probably damaging 1.00
R9277:Nalcn UTSW 14 123,518,523 (GRCm39) missense probably damaging 0.98
R9376:Nalcn UTSW 14 123,515,713 (GRCm39) missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123,522,653 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,831,980 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,531,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTTGCCAAAGGAACCGTCAC -3'
(R):5'- TGGCCTTGTCTAGAGCGTCCTTAC -3'

Sequencing Primer
(F):5'- GAACCGTCACAGGATCGTC -3'
(R):5'- tctttctttctttctttcttccttcc -3'
Posted On 2013-04-24