Incidental Mutation 'R0359:Dip2b'
ID 30021
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 038565-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R0359 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 100109874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1453 (D1453G)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: D1219G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: D1219G

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: D1453G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: D1453G

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108971
AA Change: D1219G

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: D1219G

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Meta Mutation Damage Score 0.7831 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,181 (GRCm39) Y255* probably null Het
2310003L06Rik A T 5: 88,112,455 (GRCm39) probably benign Het
Abcb5 A G 12: 118,904,067 (GRCm39) S213P probably damaging Het
Agpat1 A G 17: 34,829,551 (GRCm39) I42V probably benign Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
BB014433 G T 8: 15,092,540 (GRCm39) C104* probably null Het
Bsn C T 9: 107,989,045 (GRCm39) G2236S possibly damaging Het
Casp9 A G 4: 141,521,221 (GRCm39) E19G probably damaging Het
Ces1g T C 8: 94,055,163 (GRCm39) probably benign Het
Cfap65 T A 1: 74,959,760 (GRCm39) M797L probably benign Het
Col14a1 A G 15: 55,271,264 (GRCm39) probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col27a1 G T 4: 63,232,964 (GRCm39) probably null Het
Col6a4 T A 9: 105,874,345 (GRCm39) H2214L probably benign Het
Ctu2 T G 8: 123,204,932 (GRCm39) S72R probably damaging Het
Cyp24a1 T A 2: 170,333,619 (GRCm39) M245L possibly damaging Het
Dgkb T A 12: 38,266,030 (GRCm39) V503E probably benign Het
Diaph3 T C 14: 87,206,938 (GRCm39) R501G probably benign Het
Dnah2 G A 11: 69,420,357 (GRCm39) T119M probably benign Het
F5 T G 1: 164,007,018 (GRCm39) V274G probably damaging Het
Farp1 A T 14: 121,492,808 (GRCm39) probably benign Het
Fcsk T C 8: 111,619,891 (GRCm39) probably null Het
Foxf1 T C 8: 121,811,742 (GRCm39) V202A possibly damaging Het
Fras1 G A 5: 96,910,449 (GRCm39) V3293I probably damaging Het
Furin C T 7: 80,041,032 (GRCm39) G602D probably damaging Het
Gclm T C 3: 122,049,269 (GRCm39) probably benign Het
Gemin4 G A 11: 76,102,988 (GRCm39) T591M probably benign Het
Glrx3 T C 7: 137,055,214 (GRCm39) S119P possibly damaging Het
Gm16485 G T 9: 8,972,437 (GRCm39) probably benign Het
Helq T C 5: 100,938,066 (GRCm39) N460S probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Kpna2 A G 11: 106,882,148 (GRCm39) L226S probably damaging Het
Myom3 G A 4: 135,505,454 (GRCm39) V448M probably damaging Het
Nalcn A G 14: 123,536,580 (GRCm39) S1224P probably damaging Het
Or52n2 A T 7: 104,542,521 (GRCm39) F105I probably damaging Het
Or56b1b C T 7: 108,164,721 (GRCm39) D94N probably benign Het
Or7a38 A G 10: 78,753,177 (GRCm39) T168A probably benign Het
Plag1 C T 4: 3,904,546 (GRCm39) C215Y probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Pot1a G A 6: 25,771,679 (GRCm39) probably benign Het
Ppfia1 T C 7: 144,038,929 (GRCm39) D494G probably damaging Het
Ppp1r1a T A 15: 103,441,915 (GRCm39) D51V probably damaging Het
Ptprz1 T A 6: 22,973,175 (GRCm39) probably benign Het
Rad51ap1 A T 6: 126,911,704 (GRCm39) V61D probably damaging Het
Reln G A 5: 22,253,798 (GRCm39) L605F probably damaging Het
Riok3 T C 18: 12,282,006 (GRCm39) I325T probably damaging Het
Sclt1 A T 3: 41,616,005 (GRCm39) probably null Het
Slc25a39 A G 11: 102,297,395 (GRCm39) V24A possibly damaging Het
Slc9a3 T G 13: 74,305,726 (GRCm39) S248A probably damaging Het
Slco6d1 T A 1: 98,394,422 (GRCm39) C369S probably benign Het
Spen T C 4: 141,244,181 (GRCm39) S285G unknown Het
Stxbp5l A G 16: 37,036,440 (GRCm39) probably benign Het
Thsd7a G A 6: 12,352,030 (GRCm39) P1055L probably damaging Het
Tmed3 C T 9: 89,581,842 (GRCm39) S207N possibly damaging Het
Trerf1 G T 17: 47,652,062 (GRCm39) noncoding transcript Het
Triml1 A T 8: 43,583,542 (GRCm39) V353E probably damaging Het
Ttn G A 2: 76,549,401 (GRCm39) R31759C probably damaging Het
Ugt2b37 T C 5: 87,398,443 (GRCm39) Q331R probably benign Het
Urb1 A G 16: 90,588,048 (GRCm39) I420T probably damaging Het
Vmn1r68 A T 7: 10,261,201 (GRCm39) L299Q probably damaging Het
Vmn1r81 T A 7: 11,993,877 (GRCm39) T244S probably damaging Het
Vps13a A G 19: 16,618,941 (GRCm39) F2875S probably damaging Het
Wscd1 A G 11: 71,657,692 (GRCm39) M166V probably damaging Het
Zfp296 T C 7: 19,313,864 (GRCm39) Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 (GRCm39) H737R probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGACTCAGTGATGTGTCCCTC -3'
(R):5'- TGACTCAGCAACACAGTGGCTC -3'

Sequencing Primer
(F):5'- GTGATGTGTCCCTCATAGCAAAC -3'
(R):5'- TTGAGACAGGCTTTGAGACCAC -3'
Posted On 2013-04-24