Incidental Mutation 'R0359:Urb1'
ID30025
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene NameURB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms4921511H13Rik, 5730405K23Rik
MMRRC Submission 038565-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0359 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location90751527-90810413 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90791160 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 420 (I420T)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
Predicted Effect probably damaging
Transcript: ENSMUST00000140920
AA Change: I420T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: I420T

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142955
Meta Mutation Damage Score 0.2001 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 145,045,371 Y255* probably null Het
2310003L06Rik A T 5: 87,964,596 probably benign Het
Abcb5 A G 12: 118,940,332 S213P probably damaging Het
Agpat1 A G 17: 34,610,577 I42V probably benign Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
BB014433 G T 8: 15,042,540 C104* probably null Het
Bsn C T 9: 108,111,846 G2236S possibly damaging Het
Casp9 A G 4: 141,793,910 E19G probably damaging Het
Ces1g T C 8: 93,328,535 probably benign Het
Cfap65 T A 1: 74,920,601 M797L probably benign Het
Col14a1 A G 15: 55,407,868 probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col27a1 G T 4: 63,314,727 probably null Het
Col6a4 T A 9: 105,997,146 H2214L probably benign Het
Ctu2 T G 8: 122,478,193 S72R probably damaging Het
Cyp24a1 T A 2: 170,491,699 M245L possibly damaging Het
Dgkb T A 12: 38,216,031 V503E probably benign Het
Diaph3 T C 14: 86,969,502 R501G probably benign Het
Dip2b A G 15: 100,211,993 D1453G probably damaging Het
Dnah2 G A 11: 69,529,531 T119M probably benign Het
F5 T G 1: 164,179,449 V274G probably damaging Het
Farp1 A T 14: 121,255,396 probably benign Het
Foxf1 T C 8: 121,085,003 V202A possibly damaging Het
Fras1 G A 5: 96,762,590 V3293I probably damaging Het
Fuk T C 8: 110,893,259 probably null Het
Furin C T 7: 80,391,284 G602D probably damaging Het
Gclm T C 3: 122,255,620 probably benign Het
Gemin4 G A 11: 76,212,162 T591M probably benign Het
Glrx3 T C 7: 137,453,485 S119P possibly damaging Het
Gm16485 G T 9: 8,972,436 probably benign Het
Helq T C 5: 100,790,200 N460S probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Kpna2 A G 11: 106,991,322 L226S probably damaging Het
Myom3 G A 4: 135,778,143 V448M probably damaging Het
Nalcn A G 14: 123,299,168 S1224P probably damaging Het
Olfr1354 A G 10: 78,917,343 T168A probably benign Het
Olfr504 C T 7: 108,565,514 D94N probably benign Het
Olfr666 A T 7: 104,893,314 F105I probably damaging Het
Plag1 C T 4: 3,904,546 C215Y probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pot1a G A 6: 25,771,680 probably benign Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ppp1r1a T A 15: 103,533,488 D51V probably damaging Het
Ptprz1 T A 6: 22,973,176 probably benign Het
Rad51ap1 A T 6: 126,934,741 V61D probably damaging Het
Reln G A 5: 22,048,800 L605F probably damaging Het
Riok3 T C 18: 12,148,949 I325T probably damaging Het
Sclt1 A T 3: 41,661,570 probably null Het
Slc25a39 A G 11: 102,406,569 V24A possibly damaging Het
Slc9a3 T G 13: 74,157,607 S248A probably damaging Het
Slco6d1 T A 1: 98,466,697 C369S probably benign Het
Spen T C 4: 141,516,870 S285G unknown Het
Stxbp5l A G 16: 37,216,078 probably benign Het
Thsd7a G A 6: 12,352,031 P1055L probably damaging Het
Tmed3 C T 9: 89,699,789 S207N possibly damaging Het
Trerf1 G T 17: 47,341,136 noncoding transcript Het
Triml1 A T 8: 43,130,505 V353E probably damaging Het
Ttn G A 2: 76,719,057 R31759C probably damaging Het
Ugt2b37 T C 5: 87,250,584 Q331R probably benign Het
Vmn1r68 A T 7: 10,527,274 L299Q probably damaging Het
Vmn1r81 T A 7: 12,259,950 T244S probably damaging Het
Vps13a A G 19: 16,641,577 F2875S probably damaging Het
Wscd1 A G 11: 71,766,866 M166V probably damaging Het
Zfp296 T C 7: 19,579,939 Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 H737R probably damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3160:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTGTTTTCAGGAGCCACACG -3'
(R):5'- GGTCCAGCTTTGACATCCTAGCAG -3'

Sequencing Primer
(F):5'- tccctgaaaccgaagtcac -3'
(R):5'- CTTTGACATCCTAGCAGTTTGTG -3'
Posted On2013-04-24