Incidental Mutation 'R0359:Trerf1'
ID 30027
Institutional Source Beutler Lab
Gene Symbol Trerf1
Ensembl Gene ENSMUSG00000064043
Gene Name transcriptional regulating factor 1
Synonyms 9430096I18Rik, Trep-132, Trep132
MMRRC Submission 038565-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.506) question?
Stock # R0359 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 47451801-47672883 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) G to T at 47652062 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077951
SMART Domains Protein: ENSMUSP00000077103
Gene: ENSMUSG00000064043

DomainStartEndE-ValueType
low complexity region 262 279 N/A INTRINSIC
low complexity region 291 342 N/A INTRINSIC
low complexity region 373 384 N/A INTRINSIC
ZnF_C2H2 512 534 1.2e-3 SMART
low complexity region 552 580 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
low complexity region 690 704 N/A INTRINSIC
low complexity region 732 742 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
ELM2 807 863 7.65e-13 SMART
SANT 912 960 2.18e-5 SMART
coiled coil region 981 1005 N/A INTRINSIC
ZnF_C2H2 1039 1063 2.75e-3 SMART
low complexity region 1092 1106 N/A INTRINSIC
ZnF_C2H2 1112 1134 1.1e-2 SMART
low complexity region 1135 1156 N/A INTRINSIC
low complexity region 1182 1200 N/A INTRINSIC
low complexity region 1208 1222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190080
Meta Mutation Damage Score 0.3624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcriptional regulating protein which interacts with CBP/p300 to regulate the human gene CYP11A1. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018F24Rik T A 5: 144,982,181 (GRCm39) Y255* probably null Het
2310003L06Rik A T 5: 88,112,455 (GRCm39) probably benign Het
Abcb5 A G 12: 118,904,067 (GRCm39) S213P probably damaging Het
Agpat1 A G 17: 34,829,551 (GRCm39) I42V probably benign Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
BB014433 G T 8: 15,092,540 (GRCm39) C104* probably null Het
Bsn C T 9: 107,989,045 (GRCm39) G2236S possibly damaging Het
Casp9 A G 4: 141,521,221 (GRCm39) E19G probably damaging Het
Ces1g T C 8: 94,055,163 (GRCm39) probably benign Het
Cfap65 T A 1: 74,959,760 (GRCm39) M797L probably benign Het
Col14a1 A G 15: 55,271,264 (GRCm39) probably benign Het
Col1a2 G A 6: 4,518,822 (GRCm39) probably benign Het
Col27a1 G T 4: 63,232,964 (GRCm39) probably null Het
Col6a4 T A 9: 105,874,345 (GRCm39) H2214L probably benign Het
Ctu2 T G 8: 123,204,932 (GRCm39) S72R probably damaging Het
Cyp24a1 T A 2: 170,333,619 (GRCm39) M245L possibly damaging Het
Dgkb T A 12: 38,266,030 (GRCm39) V503E probably benign Het
Diaph3 T C 14: 87,206,938 (GRCm39) R501G probably benign Het
Dip2b A G 15: 100,109,874 (GRCm39) D1453G probably damaging Het
Dnah2 G A 11: 69,420,357 (GRCm39) T119M probably benign Het
F5 T G 1: 164,007,018 (GRCm39) V274G probably damaging Het
Farp1 A T 14: 121,492,808 (GRCm39) probably benign Het
Fcsk T C 8: 111,619,891 (GRCm39) probably null Het
Foxf1 T C 8: 121,811,742 (GRCm39) V202A possibly damaging Het
Fras1 G A 5: 96,910,449 (GRCm39) V3293I probably damaging Het
Furin C T 7: 80,041,032 (GRCm39) G602D probably damaging Het
Gclm T C 3: 122,049,269 (GRCm39) probably benign Het
Gemin4 G A 11: 76,102,988 (GRCm39) T591M probably benign Het
Glrx3 T C 7: 137,055,214 (GRCm39) S119P possibly damaging Het
Gm16485 G T 9: 8,972,437 (GRCm39) probably benign Het
Helq T C 5: 100,938,066 (GRCm39) N460S probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Kpna2 A G 11: 106,882,148 (GRCm39) L226S probably damaging Het
Myom3 G A 4: 135,505,454 (GRCm39) V448M probably damaging Het
Nalcn A G 14: 123,536,580 (GRCm39) S1224P probably damaging Het
Or52n2 A T 7: 104,542,521 (GRCm39) F105I probably damaging Het
Or56b1b C T 7: 108,164,721 (GRCm39) D94N probably benign Het
Or7a38 A G 10: 78,753,177 (GRCm39) T168A probably benign Het
Plag1 C T 4: 3,904,546 (GRCm39) C215Y probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Pot1a G A 6: 25,771,679 (GRCm39) probably benign Het
Ppfia1 T C 7: 144,038,929 (GRCm39) D494G probably damaging Het
Ppp1r1a T A 15: 103,441,915 (GRCm39) D51V probably damaging Het
Ptprz1 T A 6: 22,973,175 (GRCm39) probably benign Het
Rad51ap1 A T 6: 126,911,704 (GRCm39) V61D probably damaging Het
Reln G A 5: 22,253,798 (GRCm39) L605F probably damaging Het
Riok3 T C 18: 12,282,006 (GRCm39) I325T probably damaging Het
Sclt1 A T 3: 41,616,005 (GRCm39) probably null Het
Slc25a39 A G 11: 102,297,395 (GRCm39) V24A possibly damaging Het
Slc9a3 T G 13: 74,305,726 (GRCm39) S248A probably damaging Het
Slco6d1 T A 1: 98,394,422 (GRCm39) C369S probably benign Het
Spen T C 4: 141,244,181 (GRCm39) S285G unknown Het
Stxbp5l A G 16: 37,036,440 (GRCm39) probably benign Het
Thsd7a G A 6: 12,352,030 (GRCm39) P1055L probably damaging Het
Tmed3 C T 9: 89,581,842 (GRCm39) S207N possibly damaging Het
Triml1 A T 8: 43,583,542 (GRCm39) V353E probably damaging Het
Ttn G A 2: 76,549,401 (GRCm39) R31759C probably damaging Het
Ugt2b37 T C 5: 87,398,443 (GRCm39) Q331R probably benign Het
Urb1 A G 16: 90,588,048 (GRCm39) I420T probably damaging Het
Vmn1r68 A T 7: 10,261,201 (GRCm39) L299Q probably damaging Het
Vmn1r81 T A 7: 11,993,877 (GRCm39) T244S probably damaging Het
Vps13a A G 19: 16,618,941 (GRCm39) F2875S probably damaging Het
Wscd1 A G 11: 71,657,692 (GRCm39) M166V probably damaging Het
Zfp296 T C 7: 19,313,864 (GRCm39) Y240H possibly damaging Het
Zfp462 A G 4: 55,013,689 (GRCm39) H737R probably damaging Het
Other mutations in Trerf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Trerf1 APN 17 47,630,501 (GRCm39) unclassified noncoding transcript
IGL01753:Trerf1 APN 17 47,626,362 (GRCm39) exon noncoding transcript
IGL02172:Trerf1 APN 17 47,628,743 (GRCm39) exon noncoding transcript
IGL02266:Trerf1 APN 17 47,626,331 (GRCm39) exon noncoding transcript
IGL02370:Trerf1 APN 17 47,625,387 (GRCm39) exon noncoding transcript
IGL02613:Trerf1 APN 17 47,659,766 (GRCm39) exon noncoding transcript
R0179:Trerf1 UTSW 17 47,627,588 (GRCm39) critical splice donor site noncoding transcript
R0284:Trerf1 UTSW 17 47,630,471 (GRCm39) unclassified noncoding transcript
R0689:Trerf1 UTSW 17 47,630,300 (GRCm39) unclassified noncoding transcript
R1460:Trerf1 UTSW 17 47,628,771 (GRCm39) exon noncoding transcript
R1727:Trerf1 UTSW 17 47,652,092 (GRCm39) exon noncoding transcript
R4222:Trerf1 UTSW 17 47,625,727 (GRCm39) exon noncoding transcript
R4562:Trerf1 UTSW 17 47,637,997 (GRCm39) exon noncoding transcript
R4770:Trerf1 UTSW 17 47,630,581 (GRCm39) unclassified noncoding transcript
R5366:Trerf1 UTSW 17 47,626,116 (GRCm39) exon noncoding transcript
R5919:Trerf1 UTSW 17 47,634,208 (GRCm39) unclassified noncoding transcript
R5963:Trerf1 UTSW 17 47,625,263 (GRCm39) exon noncoding transcript
R5975:Trerf1 UTSW 17 47,625,197 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GCAGACTGTGCTTGTTGATGCC -3'
(R):5'- GGGTGAGAACACATGCCTATGAGAC -3'

Sequencing Primer
(F):5'- cggctcagtgggtaaagg -3'
(R):5'- TATGAGACAGGACCCTAGTCTGC -3'
Posted On 2013-04-24