Incidental Mutation 'R0360:Or1j19'
ID 30032
Institutional Source Beutler Lab
Gene Symbol Or1j19
Ensembl Gene ENSMUSG00000049315
Gene Name olfactory receptor family 1 subfamily J member 19
Synonyms GA_x6K02T2NLDC-33481050-33481991, Olfr348, MOR136-8
MMRRC Submission 038566-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R0360 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36676539-36677480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36677452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 305 (M305K)
Ref Sequence ENSEMBL: ENSMUSP00000150343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056865] [ENSMUST00000112950] [ENSMUST00000213498] [ENSMUST00000214909] [ENSMUST00000215199] [ENSMUST00000216753] [ENSMUST00000217041]
AlphaFold Q8VGK3
Predicted Effect probably benign
Transcript: ENSMUST00000056865
AA Change: M305K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000054037
Gene: ENSMUSG00000049315
AA Change: M305K

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 2.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112950
AA Change: M305K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108572
Gene: ENSMUSG00000111021
AA Change: M305K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 306 3e-6 PFAM
Pfam:7tm_1 42 291 3.5e-34 PFAM
Pfam:7tm_4 140 284 3.9e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213498
AA Change: M305K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000214909
AA Change: M305K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215199
AA Change: M305K

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216753
Predicted Effect probably benign
Transcript: ENSMUST00000217041
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,310,553 (GRCm39) probably benign Het
Adcyap1r1 G T 6: 55,452,508 (GRCm39) probably benign Het
Ankrd6 T C 4: 32,836,424 (GRCm39) T44A probably damaging Het
Ano7 A G 1: 93,316,380 (GRCm39) D221G probably benign Het
Bhlhe40 C A 6: 108,641,711 (GRCm39) N218K probably damaging Het
Bms1 A G 6: 118,382,251 (GRCm39) V429A probably benign Het
C7 T A 15: 5,018,444 (GRCm39) T800S probably benign Het
Camta2 G A 11: 70,574,136 (GRCm39) T127I probably damaging Het
Ccdc13 T A 9: 121,627,282 (GRCm39) N665I probably damaging Het
Ccdc157 T C 11: 4,096,663 (GRCm39) E362G probably damaging Het
Ccdc73 T A 2: 104,811,352 (GRCm39) N310K probably damaging Het
Cfap91 T A 16: 38,118,659 (GRCm39) probably null Het
Cmklr1 A T 5: 113,752,578 (GRCm39) L141H probably damaging Het
Cnst C A 1: 179,407,100 (GRCm39) A49E probably benign Het
Col5a3 C T 9: 20,683,762 (GRCm39) R1498Q unknown Het
Crybb3 T A 5: 113,223,819 (GRCm39) I197F probably damaging Het
Cryzl1 G A 16: 91,504,155 (GRCm39) P97S probably benign Het
Cubn T C 2: 13,315,318 (GRCm39) probably benign Het
Cyp2d37-ps T C 15: 82,574,253 (GRCm39) noncoding transcript Het
Cyp4a12b C A 4: 115,290,117 (GRCm39) N223K probably benign Het
D16Ertd472e A T 16: 78,344,773 (GRCm39) C112S probably benign Het
Dennd2a T C 6: 39,485,233 (GRCm39) T349A probably benign Het
Dock5 G A 14: 68,060,129 (GRCm39) probably benign Het
Dpp6 T C 5: 27,857,267 (GRCm39) L404P probably damaging Het
Dsc3 T A 18: 20,104,639 (GRCm39) T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 (GRCm39) E214D possibly damaging Het
Elac2 A G 11: 64,870,136 (GRCm39) Y67C probably damaging Het
Elmo1 A T 13: 20,748,663 (GRCm39) K503* probably null Het
Eng T C 2: 32,569,149 (GRCm39) S559P probably benign Het
Epc2 T A 2: 49,427,145 (GRCm39) V563E possibly damaging Het
Fancm A G 12: 65,122,724 (GRCm39) Y82C probably damaging Het
Flt4 A T 11: 49,527,818 (GRCm39) M924L probably benign Het
Gabpa T A 16: 84,654,275 (GRCm39) N317K possibly damaging Het
Gchfr T G 2: 118,998,327 (GRCm39) Y3* probably null Het
Gli3 G T 13: 15,899,349 (GRCm39) G912V probably benign Het
Gm10295 C A 7: 71,000,361 (GRCm39) C73F unknown Het
Gm10382 G T 5: 125,466,728 (GRCm39) probably benign Het
Gp1ba T C 11: 70,531,284 (GRCm39) probably benign Het
Gpr146 G A 5: 139,364,933 (GRCm39) probably benign Het
Hexd T A 11: 121,102,969 (GRCm39) H62Q probably benign Het
Hgd T A 16: 37,431,546 (GRCm39) probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Icam4 A G 9: 20,941,117 (GRCm39) Y123C probably damaging Het
Il24 A G 1: 130,811,674 (GRCm39) V134A probably damaging Het
Iqcb1 G T 16: 36,692,670 (GRCm39) A562S probably damaging Het
Iqgap2 A C 13: 95,867,783 (GRCm39) probably benign Het
Islr2 T C 9: 58,107,027 (GRCm39) T78A possibly damaging Het
Kif1b A G 4: 149,347,186 (GRCm39) I330T probably damaging Het
Kirrel1 T C 3: 86,997,106 (GRCm39) Y287C probably damaging Het
Klf10 C T 15: 38,297,090 (GRCm39) V317M probably benign Het
Klhl9 T G 4: 88,638,527 (GRCm39) K571N probably benign Het
Lin37 T C 7: 30,256,438 (GRCm39) I97V possibly damaging Het
Lrrc37a C T 11: 103,391,466 (GRCm39) V1320I possibly damaging Het
Lrrc74a A G 12: 86,784,569 (GRCm39) H99R probably damaging Het
Me3 T A 7: 89,435,622 (GRCm39) probably null Het
Med13 T C 11: 86,219,987 (GRCm39) probably benign Het
Myh6 A T 14: 55,185,804 (GRCm39) Y1490* probably null Het
Myo10 T C 15: 25,804,454 (GRCm39) L1583P probably damaging Het
Nkx6-3 A G 8: 23,647,722 (GRCm39) E227G possibly damaging Het
Nlrp1a T A 11: 71,004,830 (GRCm39) probably benign Het
Nlrp5-ps A C 7: 14,317,016 (GRCm39) noncoding transcript Het
Nup188 T G 2: 30,216,491 (GRCm39) I765S probably null Het
Obscn G A 11: 59,019,107 (GRCm39) A969V probably benign Het
Or11a4 T C 17: 37,536,934 (GRCm39) L306P possibly damaging Het
Or5a1 G T 19: 12,097,217 (GRCm39) D286E possibly damaging Het
Or8k33 A T 2: 86,384,123 (GRCm39) L115Q probably damaging Het
Otogl T A 10: 107,606,511 (GRCm39) probably benign Het
Pcnx3 G A 19: 5,715,611 (GRCm39) R1472W probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Plscr4 T A 9: 92,370,814 (GRCm39) probably benign Het
Pon2 G A 6: 5,266,156 (GRCm39) Q288* probably null Het
Ptpn13 C A 5: 103,681,214 (GRCm39) R805S probably damaging Het
Pyroxd2 A T 19: 42,735,992 (GRCm39) V62D probably damaging Het
Rab37 G T 11: 115,047,790 (GRCm39) C44F probably damaging Het
Rbm44 T C 1: 91,080,069 (GRCm39) S52P probably benign Het
Rgl3 A G 9: 21,888,153 (GRCm39) W454R probably damaging Het
Rita1 A G 5: 120,747,837 (GRCm39) S154P probably benign Het
Scn5a T C 9: 119,351,665 (GRCm39) D772G probably damaging Het
Sec23ip G A 7: 128,363,129 (GRCm39) probably benign Het
Skic8 A T 9: 54,634,862 (GRCm39) probably benign Het
Slc23a1 T A 18: 35,756,032 (GRCm39) probably benign Het
Slco1a8 A C 6: 141,928,053 (GRCm39) probably benign Het
Sparcl1 T A 5: 104,237,503 (GRCm39) D444V probably damaging Het
Taar6 C A 10: 23,861,046 (GRCm39) V167L probably benign Het
Tmcc3 T A 10: 94,414,407 (GRCm39) N36K probably benign Het
Tmem200c T A 17: 69,147,543 (GRCm39) V42E probably damaging Het
Trhde T C 10: 114,338,887 (GRCm39) probably benign Het
Tshz3 A G 7: 36,469,958 (GRCm39) E649G probably benign Het
Utp4 T C 8: 107,625,169 (GRCm39) probably benign Het
Vmn1r30 A G 6: 58,412,262 (GRCm39) V190A probably benign Het
Vmn1r35 A G 6: 66,655,827 (GRCm39) I281T probably damaging Het
Vmn1r58 G T 7: 5,413,329 (GRCm39) H300Q probably benign Het
Vmn1r84 A G 7: 12,095,799 (GRCm39) L286P probably damaging Het
Vmn2r54 A T 7: 12,349,576 (GRCm39) C669S probably damaging Het
Zfp623 T C 15: 75,820,510 (GRCm39) S489P probably benign Het
Other mutations in Or1j19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Or1j19 APN 2 36,677,367 (GRCm39) missense probably benign 0.03
IGL01943:Or1j19 APN 2 36,677,095 (GRCm39) missense probably benign 0.13
IGL02030:Or1j19 APN 2 36,677,410 (GRCm39) missense probably damaging 1.00
IGL02338:Or1j19 APN 2 36,676,557 (GRCm39) nonsense probably null
IGL02349:Or1j19 APN 2 36,677,058 (GRCm39) missense possibly damaging 0.95
IGL02695:Or1j19 APN 2 36,677,332 (GRCm39) missense possibly damaging 0.72
IGL03004:Or1j19 APN 2 36,677,194 (GRCm39) missense probably damaging 1.00
IGL03007:Or1j19 APN 2 36,676,812 (GRCm39) missense probably damaging 0.99
IGL03024:Or1j19 APN 2 36,676,858 (GRCm39) missense possibly damaging 0.55
R0388:Or1j19 UTSW 2 36,676,874 (GRCm39) missense probably benign 0.43
R0614:Or1j19 UTSW 2 36,676,705 (GRCm39) missense probably damaging 1.00
R1498:Or1j19 UTSW 2 36,677,358 (GRCm39) missense probably damaging 1.00
R1562:Or1j19 UTSW 2 36,676,696 (GRCm39) missense probably damaging 1.00
R2882:Or1j19 UTSW 2 36,677,202 (GRCm39) missense probably damaging 1.00
R3731:Or1j19 UTSW 2 36,676,578 (GRCm39) missense possibly damaging 0.53
R4513:Or1j19 UTSW 2 36,676,782 (GRCm39) missense probably benign 0.05
R4899:Or1j19 UTSW 2 36,676,810 (GRCm39) missense probably benign 0.04
R5005:Or1j19 UTSW 2 36,677,370 (GRCm39) missense probably benign
R5035:Or1j19 UTSW 2 36,676,903 (GRCm39) missense probably damaging 1.00
R5490:Or1j19 UTSW 2 36,677,193 (GRCm39) missense probably damaging 1.00
R6361:Or1j19 UTSW 2 36,676,792 (GRCm39) missense probably damaging 1.00
R7762:Or1j19 UTSW 2 36,677,022 (GRCm39) missense probably benign 0.03
R8109:Or1j19 UTSW 2 36,676,618 (GRCm39) missense probably benign 0.00
R8223:Or1j19 UTSW 2 36,677,409 (GRCm39) missense
R8826:Or1j19 UTSW 2 36,676,855 (GRCm39) nonsense probably null
R8906:Or1j19 UTSW 2 36,676,621 (GRCm39) missense probably benign 0.01
R9138:Or1j19 UTSW 2 36,676,702 (GRCm39) missense probably benign 0.00
R9147:Or1j19 UTSW 2 36,676,938 (GRCm39) missense probably benign 0.01
R9148:Or1j19 UTSW 2 36,676,938 (GRCm39) missense probably benign 0.01
R9267:Or1j19 UTSW 2 36,676,530 (GRCm39) unclassified probably benign
R9306:Or1j19 UTSW 2 36,677,407 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTTCTCACCTCTCTGTGGT -3'
(R):5'- ACATGGTAGAGTGGCGATTCTGGATAA -3'

Sequencing Primer
(F):5'- CCTCTCTGTGGTTTCTCTCTATTATG -3'
(R):5'- GAGGAAACAACTTTGCTACAAAATG -3'
Posted On 2013-04-24