Incidental Mutation 'R0360:Dpp6'
ID30036
Institutional Source Beutler Lab
Gene Symbol Dpp6
Ensembl Gene ENSMUSG00000061576
Gene Namedipeptidylpeptidase 6
SynonymsRw, LOC384168, Peplb, Dpp-6, B930011P16Rik, In(5)6H-p
MMRRC Submission 038566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R0360 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location26817203-27727505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27652269 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 404 (L404P)
Ref Sequence ENSEMBL: ENSMUSP00000113441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071500] [ENSMUST00000101471] [ENSMUST00000120555] [ENSMUST00000122171]
Predicted Effect probably damaging
Transcript: ENSMUST00000071500
AA Change: L349P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071435
Gene: ENSMUSG00000061576
AA Change: L349P

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Pfam:DPPIV_N 134 500 7.2e-114 PFAM
Pfam:PD40 365 402 1.1e-5 PFAM
Pfam:Peptidase_S9 579 789 2.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101471
AA Change: L348P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099012
Gene: ENSMUSG00000061576
AA Change: L348P

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:DPPIV_N 133 499 2.6e-114 PFAM
Pfam:PD40 364 401 9.3e-6 PFAM
Pfam:Peptidase_S9 578 788 1.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120555
AA Change: L346P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113849
Gene: ENSMUSG00000061576
AA Change: L346P

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
Pfam:DPPIV_N 131 497 2.6e-114 PFAM
Pfam:PD40 362 399 9.2e-6 PFAM
Pfam:Peptidase_S9 576 786 1.9e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122171
AA Change: L404P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113441
Gene: ENSMUSG00000061576
AA Change: L404P

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
transmembrane domain 90 112 N/A INTRINSIC
Pfam:DPPIV_N 189 555 6.4e-113 PFAM
Pfam:PD40 425 457 1.1e-4 PFAM
Pfam:Peptidase_S9 634 844 4.3e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134175
Meta Mutation Damage Score 0.8604 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the peptidase S9B family of serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Variations in this gene may be associated with susceptibility to amyotrophic lateral sclerosis and with idiopathic ventricular fibrillation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit loss of A-type K+ current gradients in distal dendrites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dsc3 T A 18: 19,971,582 T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fancm A G 12: 65,075,950 Y82C probably damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hgd T A 16: 37,611,184 probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Il24 A G 1: 130,883,937 V134A probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Pcnx3 G A 19: 5,665,583 R1472W probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Sparcl1 T A 5: 104,089,637 D444V probably damaging Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Vmn2r54 A T 7: 12,615,649 C669S probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Dpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Dpp6 APN 5 27723443 missense probably damaging 1.00
IGL01137:Dpp6 APN 5 27714488 missense probably damaging 1.00
IGL01386:Dpp6 APN 5 27664762 critical splice donor site probably null
IGL01409:Dpp6 APN 5 27557601 missense probably damaging 1.00
IGL01721:Dpp6 APN 5 27631520 missense probably damaging 1.00
IGL02149:Dpp6 APN 5 27538024 missense probably benign 0.00
IGL02174:Dpp6 APN 5 27721087 nonsense probably null
IGL02176:Dpp6 APN 5 27723577 missense probably damaging 0.98
IGL02326:Dpp6 APN 5 27664757 missense probably damaging 1.00
IGL02336:Dpp6 APN 5 27469411 missense probably benign 0.04
IGL02339:Dpp6 APN 5 27652230 missense probably damaging 0.97
IGL02402:Dpp6 APN 5 27634543 missense probably damaging 1.00
IGL02884:Dpp6 APN 5 27634556 missense possibly damaging 0.88
IGL02885:Dpp6 APN 5 27718473 missense probably damaging 1.00
IGL02938:Dpp6 APN 5 27723367 splice site probably benign
IGL03083:Dpp6 APN 5 27709550 critical splice donor site probably null
I0000:Dpp6 UTSW 5 27398922 missense probably benign 0.02
IGL03052:Dpp6 UTSW 5 27709508 missense probably benign 0.03
PIT4431001:Dpp6 UTSW 5 27631498 missense probably benign 0.03
R0060:Dpp6 UTSW 5 27598819 missense probably damaging 1.00
R0486:Dpp6 UTSW 5 27661642 missense probably benign 0.39
R0501:Dpp6 UTSW 5 27725606 missense probably damaging 1.00
R1028:Dpp6 UTSW 5 27666427 missense probably benign 0.01
R1164:Dpp6 UTSW 5 27721105 missense probably benign 0.02
R1177:Dpp6 UTSW 5 27663473 missense possibly damaging 0.94
R1993:Dpp6 UTSW 5 27399006 missense probably benign 0.00
R2024:Dpp6 UTSW 5 27709459 missense possibly damaging 0.67
R2100:Dpp6 UTSW 5 27664744 missense probably damaging 0.96
R2329:Dpp6 UTSW 5 27451288 splice site probably null
R3619:Dpp6 UTSW 5 27721120 missense possibly damaging 0.74
R3871:Dpp6 UTSW 5 27469465 missense probably benign 0.03
R3872:Dpp6 UTSW 5 27721058 missense probably damaging 1.00
R4114:Dpp6 UTSW 5 27469487 critical splice donor site probably null
R4403:Dpp6 UTSW 5 27718462 missense probably damaging 1.00
R4599:Dpp6 UTSW 5 27634548 missense probably damaging 1.00
R4736:Dpp6 UTSW 5 27712659 missense probably damaging 1.00
R4929:Dpp6 UTSW 5 27049787 missense probably benign 0.25
R4967:Dpp6 UTSW 5 27666511 missense probably damaging 1.00
R5162:Dpp6 UTSW 5 27399015 unclassified probably benign
R5270:Dpp6 UTSW 5 27634534 missense probably damaging 0.98
R5334:Dpp6 UTSW 5 27709540 missense probably benign 0.30
R5437:Dpp6 UTSW 5 27663501 nonsense probably null
R5663:Dpp6 UTSW 5 27049622 missense possibly damaging 0.84
R6023:Dpp6 UTSW 5 27723547 missense probably damaging 0.96
R6244:Dpp6 UTSW 5 27049628 missense probably damaging 0.99
R6312:Dpp6 UTSW 5 27725671 missense possibly damaging 0.84
R6442:Dpp6 UTSW 5 27718509 critical splice donor site probably null
R6942:Dpp6 UTSW 5 27469459 missense possibly damaging 0.79
R6956:Dpp6 UTSW 5 27598821 missense probably damaging 1.00
R7210:Dpp6 UTSW 5 27598803 missense probably damaging 0.99
R7342:Dpp6 UTSW 5 27714554 missense probably benign
R7702:Dpp6 UTSW 5 27652276 missense probably benign 0.00
R7727:Dpp6 UTSW 5 27451244 missense probably benign 0.30
R7899:Dpp6 UTSW 5 27721079 missense probably benign 0.03
R7966:Dpp6 UTSW 5 27723372 missense probably benign 0.06
R8015:Dpp6 UTSW 5 26817810 start gained probably benign
R8084:Dpp6 UTSW 5 27631399 missense probably benign 0.32
R8178:Dpp6 UTSW 5 27598817 missense probably damaging 1.00
R8384:Dpp6 UTSW 5 27718474 missense probably benign 0.18
Z1176:Dpp6 UTSW 5 27398998 missense probably damaging 1.00
Z1177:Dpp6 UTSW 5 27712642 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTGAAACTGAAGTCAGTAGAGCCC -3'
(R):5'- ACCAAACCAGAGGCTGGACATAATG -3'

Sequencing Primer
(F):5'- TCGGTTTTAAGAGCCCAGC -3'
(R):5'- CTGGACATAATGTCAATGACAGAGC -3'
Posted On2013-04-24