Incidental Mutation 'R0360:Sparcl1'
Institutional Source Beutler Lab
Gene Symbol Sparcl1
Ensembl Gene ENSMUSG00000029309
Gene NameSPARC-like 1
SynonymsEcm2, mast9, Sc1, hevin
MMRRC Submission 038566-MU
Accession Numbers

Ncbi RefSeq: NM_010097.4; MGI:108110

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0360 (G1)
Quality Score225
Status Validated
Chromosomal Location104079111-104113733 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104089637 bp
Amino Acid Change Aspartic acid to Valine at position 444 (D444V)
Ref Sequence ENSEMBL: ENSMUSP00000031249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031249] [ENSMUST00000199947]
Predicted Effect probably damaging
Transcript: ENSMUST00000031249
AA Change: D444V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031249
Gene: ENSMUSG00000029309
AA Change: D444V

signal peptide 1 16 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 90 101 N/A INTRINSIC
low complexity region 192 210 N/A INTRINSIC
low complexity region 330 340 N/A INTRINSIC
low complexity region 372 381 N/A INTRINSIC
FOLN 418 441 2.33e-5 SMART
KAZAL 441 495 3.62e-11 SMART
Pfam:SPARC_Ca_bdg 498 636 2.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199947
SMART Domains Protein: ENSMUSP00000143177
Gene: ENSMUSG00000029309

signal peptide 1 16 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 90 101 N/A INTRINSIC
low complexity region 192 210 N/A INTRINSIC
Meta Mutation Damage Score 0.2506 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype Strain: 2153047
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(1) Gene trapped(4)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dpp6 T C 5: 27,652,269 L404P probably damaging Het
Dsc3 T A 18: 19,971,582 T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fancm A G 12: 65,075,950 Y82C probably damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hgd T A 16: 37,611,184 probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Il24 A G 1: 130,883,937 V134A probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Pcnx3 G A 19: 5,665,583 R1472W probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Vmn2r54 A T 7: 12,615,649 C669S probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Sparcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Sparcl1 APN 5 104092922 missense probably benign 0.04
IGL01291:Sparcl1 APN 5 104094715 missense possibly damaging 0.88
IGL01958:Sparcl1 APN 5 104092540 missense probably benign 0.30
IGL02749:Sparcl1 APN 5 104092880 missense possibly damaging 0.57
IGL03034:Sparcl1 APN 5 104093237 missense probably damaging 0.96
ANU05:Sparcl1 UTSW 5 104094715 missense possibly damaging 0.88
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0007:Sparcl1 UTSW 5 104087080 missense probably damaging 1.00
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0071:Sparcl1 UTSW 5 104085841 nonsense probably null
R0278:Sparcl1 UTSW 5 104088397 missense probably benign 0.16
R0581:Sparcl1 UTSW 5 104093312 missense probably damaging 0.99
R1755:Sparcl1 UTSW 5 104092824 missense probably benign 0.12
R1807:Sparcl1 UTSW 5 104085761 missense probably damaging 1.00
R1925:Sparcl1 UTSW 5 104093354 missense probably benign 0.09
R2110:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2112:Sparcl1 UTSW 5 104088423 missense probably damaging 1.00
R2331:Sparcl1 UTSW 5 104085794 missense probably damaging 1.00
R2567:Sparcl1 UTSW 5 104085088 missense probably damaging 1.00
R3029:Sparcl1 UTSW 5 104093226 missense possibly damaging 0.59
R3104:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3106:Sparcl1 UTSW 5 104093337 missense probably benign 0.00
R3979:Sparcl1 UTSW 5 104092781 missense probably benign 0.00
R4772:Sparcl1 UTSW 5 104088490 missense probably benign 0.15
R4967:Sparcl1 UTSW 5 104092910 missense probably damaging 1.00
R5095:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5103:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5105:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5140:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R5149:Sparcl1 UTSW 5 104085763 missense probably damaging 1.00
R6245:Sparcl1 UTSW 5 104085147 missense probably damaging 1.00
R6387:Sparcl1 UTSW 5 104085060 missense probably damaging 1.00
R6544:Sparcl1 UTSW 5 104092444 nonsense probably null
R6930:Sparcl1 UTSW 5 104087074 missense probably damaging 1.00
R7246:Sparcl1 UTSW 5 104085157 missense probably benign 0.00
R8490:Sparcl1 UTSW 5 104085708 missense probably null 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cccacctcccatccttagac -3'
Protein Function and Prediction

Sparcl1 encodes Hevin/Sc1, an matricellular secreted glycoprotein in the SPARC family (1). Hevin has three major domains: an N-terminal acidic domain, a follistatin-like domain, and the extracellular calcium-binding domain (1). The follistain-like domain is homologous to a domain in follistatin, a protein that inhibits members of the TGF-β superfamily (1).  Hevin has been shown to inhibit the attachment and spreading of endothelial cells and to reduce focal adhesion formation by endothelial cells (2). Therefore, the proposed function of hevin is to modulate cell migration. Girard and Springer propose that hevin participates in lymphocyte transendothelial migration and might alter vascular permeability (2). The related protein, SPARC, functions as a cell cycle inhibitor, de-adhesive protein, a regulator of growth factor activity, and modulatory cell-matrix interactions (3).


Northern blot analysis detected expression of Sparcl1 in lymph node, brain, heart, lung, skeletal muscle, ovary, small intestine, and colon, with lower levels in placenta, pancreas, testis, spleen, and thymus, and no expression in kidney, liver, and peripheral blood leukocytes (4).


Sparcl1tm1Pmc/tm1Pmc; MGI:2153047

involves: 129S1/Sv

Homozygotes exhibit stunted and less branched processes extending from extending from Purkinje cell bodies compared to in wild-type mice and exhibit an increase in glial cells compared to in wild-type mice (5).


Sparcl1tm1Pmc/tm1Pmc; MGI:2153047

involves: 129S1/Sv * C57BL/6

Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal histology and survival (6).

Posted On2013-04-24
Science WriterAnne Murray