Incidental Mutation 'R0360:Vmn2r54'
ID30046
Institutional Source Beutler Lab
Gene Symbol Vmn2r54
Ensembl Gene ENSMUSG00000096593
Gene Namevomeronasal 2, receptor 54
SynonymsEG666085, Gm470, LOC232871, LOC385080
MMRRC Submission 038566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0360 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location12615233-12636134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 12615649 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 669 (C669S)
Ref Sequence ENSEMBL: ENSMUSP00000083386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086210]
Predicted Effect probably damaging
Transcript: ENSMUST00000086210
AA Change: C669S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083386
Gene: ENSMUSG00000096593
AA Change: C669S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 4.3e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 1.2e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dpp6 T C 5: 27,652,269 L404P probably damaging Het
Dsc3 T A 18: 19,971,582 T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fancm A G 12: 65,075,950 Y82C probably damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hgd T A 16: 37,611,184 probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Il24 A G 1: 130,883,937 V134A probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Pcnx3 G A 19: 5,665,583 R1472W probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Sparcl1 T A 5: 104,089,637 D444V probably damaging Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Vmn2r54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Vmn2r54 APN 7 12631913 splice site probably benign
IGL01778:Vmn2r54 APN 7 12632082 missense probably benign 0.07
IGL01998:Vmn2r54 APN 7 12615300 missense probably benign
IGL02028:Vmn2r54 APN 7 12632161 missense probably damaging 1.00
IGL02064:Vmn2r54 APN 7 12615606 missense probably benign 0.02
IGL02238:Vmn2r54 APN 7 12635983 missense probably damaging 1.00
IGL03062:Vmn2r54 APN 7 12632428 missense probably damaging 0.98
IGL03120:Vmn2r54 APN 7 12615387 missense probably damaging 1.00
PIT4453001:Vmn2r54 UTSW 7 12629742 missense probably benign 0.06
R0212:Vmn2r54 UTSW 7 12632497 missense probably benign
R1646:Vmn2r54 UTSW 7 12632507 missense probably damaging 1.00
R1673:Vmn2r54 UTSW 7 12616211 critical splice acceptor site probably null
R1738:Vmn2r54 UTSW 7 12635888 missense probably benign 0.00
R1856:Vmn2r54 UTSW 7 12632311 missense probably benign
R2012:Vmn2r54 UTSW 7 12615877 missense probably damaging 1.00
R2038:Vmn2r54 UTSW 7 12629710 missense possibly damaging 0.94
R2160:Vmn2r54 UTSW 7 12615493 missense probably benign 0.29
R2397:Vmn2r54 UTSW 7 12615651 missense probably damaging 0.98
R2430:Vmn2r54 UTSW 7 12632006 missense probably damaging 0.99
R2829:Vmn2r54 UTSW 7 12615690 missense possibly damaging 0.62
R2975:Vmn2r54 UTSW 7 12635992 missense possibly damaging 0.92
R3005:Vmn2r54 UTSW 7 12615294 missense probably benign 0.28
R3725:Vmn2r54 UTSW 7 12632296 missense probably benign 0.42
R4486:Vmn2r54 UTSW 7 12632272 nonsense probably null
R4881:Vmn2r54 UTSW 7 12629671 missense probably benign 0.00
R4907:Vmn2r54 UTSW 7 12616223 splice site probably null
R5536:Vmn2r54 UTSW 7 12632416 missense probably benign 0.03
R5637:Vmn2r54 UTSW 7 12615369 missense probably benign 0.41
R5703:Vmn2r54 UTSW 7 12629667 missense probably benign 0.22
R5769:Vmn2r54 UTSW 7 12615282 missense possibly damaging 0.73
R5972:Vmn2r54 UTSW 7 12615352 missense probably damaging 1.00
R5972:Vmn2r54 UTSW 7 12635947 missense probably damaging 1.00
R5977:Vmn2r54 UTSW 7 12632216 missense probably damaging 1.00
R6084:Vmn2r54 UTSW 7 12632278 missense probably damaging 0.98
R6176:Vmn2r54 UTSW 7 12615981 missense probably damaging 1.00
R6229:Vmn2r54 UTSW 7 12631956 missense probably benign 0.00
R6371:Vmn2r54 UTSW 7 12615435 missense probably damaging 1.00
R6374:Vmn2r54 UTSW 7 12615493 missense probably damaging 1.00
R6804:Vmn2r54 UTSW 7 12629865 missense probably benign
R6886:Vmn2r54 UTSW 7 12632153 missense probably benign 0.02
R7041:Vmn2r54 UTSW 7 12629824 missense probably damaging 0.99
R7058:Vmn2r54 UTSW 7 12615795 missense possibly damaging 0.70
R7113:Vmn2r54 UTSW 7 12616074 missense probably damaging 1.00
R7124:Vmn2r54 UTSW 7 12622151 missense probably benign 0.00
R7126:Vmn2r54 UTSW 7 12632161 missense possibly damaging 0.91
R7236:Vmn2r54 UTSW 7 12631990 missense possibly damaging 0.84
R7337:Vmn2r54 UTSW 7 12622117 missense probably benign 0.00
R7406:Vmn2r54 UTSW 7 12616223 splice site probably null
R7634:Vmn2r54 UTSW 7 12615703 missense probably damaging 1.00
R7793:Vmn2r54 UTSW 7 12632269 missense probably damaging 0.98
U24488:Vmn2r54 UTSW 7 12615429 missense possibly damaging 0.84
X0066:Vmn2r54 UTSW 7 12615370 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACTTGGGGATGAAGATGCCAC -3'
(R):5'- TCAGAGTCACCAGACCACGAAGTAG -3'

Sequencing Primer
(F):5'- TACAGCCACAGTGGACTTTC -3'
(R):5'- GGTACTTCAACCTTTGTGGTCC -3'
Posted On2013-04-24