Mutagenetix > Incidental Mutation

Incidental Mutation 'R0360:Col5a3'

30052

Institutional Source

Beutler Lab

Gene Symbol

Col5a3

Ensembl Gene

ENSMUSG00000004098

Gene Name

collagen, type V, alpha 3

Synonyms

Pro-alpha3(V)

MMRRC Submission

038566-MU

Accession Numbers

Ncbi RefSeq: NM_016919.2; MGI:1858212

Essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R0360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20770050-20815067 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 20772466 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 1498 (R1498Q)

Ref Sequence

ENSEMBL: ENSMUSP00000004201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004201]

AlphaFold

Q9JLI2

Predicted Effect

unknown
Transcript: ENSMUST00000004201
AA Change: R1498Q

SMART Domains

Protein: ENSMUSP00000004201
Gene: ENSMUSG00000004098
AA Change: R1498Q

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSPN	32	211	7.08e-28	SMART
LamG	89	210	2.13e-2	SMART
low complexity region	247	267	N/A	INTRINSIC
low complexity region	295	314	N/A	INTRINSIC
low complexity region	341	347	N/A	INTRINSIC
low complexity region	369	381	N/A	INTRINSIC
low complexity region	391	434	N/A	INTRINSIC
low complexity region	461	474	N/A	INTRINSIC
Pfam:Collagen	475	538	5.5e-10	PFAM
low complexity region	597	616	N/A	INTRINSIC
low complexity region	628	694	N/A	INTRINSIC
internal_repeat_3	703	737	7.13e-16	PROSPERO
low complexity region	742	821	N/A	INTRINSIC
low complexity region	823	844	N/A	INTRINSIC
low complexity region	859	889	N/A	INTRINSIC
internal_repeat_2	892	1081	5.05e-17	PROSPERO
internal_repeat_1	996	1133	7.47e-22	PROSPERO
internal_repeat_3	1105	1139	7.13e-16	PROSPERO
low complexity region	1140	1165	N/A	INTRINSIC
low complexity region	1168	1255	N/A	INTRINSIC
low complexity region	1258	1282	N/A	INTRINSIC
low complexity region	1285	1306	N/A	INTRINSIC
low complexity region	1311	1418	N/A	INTRINSIC
Pfam:Collagen	1429	1491	9.5e-10	PFAM
COLFI	1508	1738	7.98e-92	SMART

Meta Mutation Damage Score

0.0718

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

98% (93/95)

MGI Phenotype

Strain: 5000519
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. Mutations in this gene are thought to be responsible for the symptoms of a subset of patients with Ehlers-Danlos syndrome type III. Messages of several sizes can be detected in northern blots but sequence information cannot confirm the identity of the shorter messages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation show decreased pancreatic beta cell mass, hyperglycemia, hypoinsulinemia, impaired glucose tolerance, insulin resistance and impaired glucose uptake. Homozygous females show decreased susceptibility to diet-induced obesity and a thin hypodermal fat layer. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	G	A	7: 28,611,128		probably benign	Het
Adcyap1r1	G	T	6: 55,475,523		probably benign	Het
Ankrd6	T	C	4: 32,836,424	T44A	probably damaging	Het
Ano7	A	G	1: 93,388,658	D221G	probably benign	Het
Bhlhe40	C	A	6: 108,664,750	N218K	probably damaging	Het
Bms1	A	G	6: 118,405,290	V429A	probably benign	Het
C7	T	A	15: 4,988,962	T800S	probably benign	Het
Camta2	G	A	11: 70,683,310	T127I	probably damaging	Het
Ccdc13	T	A	9: 121,798,216	N665I	probably damaging	Het
Ccdc157	T	C	11: 4,146,663	E362G	probably damaging	Het
Ccdc73	T	A	2: 104,981,007	N310K	probably damaging	Het
Cmklr1	A	T	5: 113,614,517	L141H	probably damaging	Het
Cnst	C	A	1: 179,579,535	A49E	probably benign	Het
Crybb3	T	A	5: 113,075,953	I197F	probably damaging	Het
Cryzl1	G	A	16: 91,707,267	P97S	probably benign	Het
Cubn	T	C	2: 13,310,507		probably benign	Het
Cyp2d37-ps	T	C	15: 82,690,052		noncoding transcript	Het
Cyp4a12b	C	A	4: 115,432,920	N223K	probably benign	Het
D16Ertd472e	A	T	16: 78,547,885	C112S	probably benign	Het
Dennd2a	T	C	6: 39,508,299	T349A	probably benign	Het
Dock5	G	A	14: 67,822,680		probably benign	Het
Dpp6	T	C	5: 27,652,269	L404P	probably damaging	Het
Dsc3	T	A	18: 19,971,582	T563S	possibly damaging	Het
Dync2h1	T	A	9: 7,113,182	E214D	possibly damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elmo1	A	T	13: 20,564,493	K503*	probably null	Het
Eng	T	C	2: 32,679,137	S559P	probably benign	Het
Epc2	T	A	2: 49,537,133	V563E	possibly damaging	Het
Fancm	A	G	12: 65,075,950	Y82C	probably damaging	Het
Flt4	A	T	11: 49,636,991	M924L	probably benign	Het
Gabpa	T	A	16: 84,857,387	N317K	possibly damaging	Het
Gchfr	T	G	2: 119,167,846	Y3*	probably null	Het
Gli3	G	T	13: 15,724,764	G912V	probably benign	Het
Gm10295	C	A	7: 71,350,613	C73F	unknown	Het
Gm10382	G	T	5: 125,389,664		probably benign	Het
Gm6614	A	C	6: 141,982,327		probably benign	Het
Gp1ba	T	C	11: 70,640,458		probably benign	Het
Gpr146	G	A	5: 139,379,178		probably benign	Het
Hexdc	T	A	11: 121,212,143	H62Q	probably benign	Het
Hgd	T	A	16: 37,611,184		probably benign	Het
Hs6st1	G	A	1: 36,069,185		probably null	Het
Icam4	A	G	9: 21,029,821	Y123C	probably damaging	Het
Il24	A	G	1: 130,883,937	V134A	probably damaging	Het
Iqcb1	G	T	16: 36,872,308	A562S	probably damaging	Het
Iqgap2	A	C	13: 95,731,275		probably benign	Het
Islr2	T	C	9: 58,199,744	T78A	possibly damaging	Het
Kif1b	A	G	4: 149,262,729	I330T	probably damaging	Het
Kirrel	T	C	3: 87,089,799	Y287C	probably damaging	Het
Klf10	C	T	15: 38,296,846	V317M	probably benign	Het
Klhl9	T	G	4: 88,720,290	K571N	probably benign	Het
Lin37	T	C	7: 30,557,013	I97V	possibly damaging	Het
Lrrc37a	C	T	11: 103,500,640	V1320I	possibly damaging	Het
Lrrc74a	A	G	12: 86,737,795	H99R	probably damaging	Het
Maats1	T	A	16: 38,298,297		probably null	Het
Me3	T	A	7: 89,786,414		probably null	Het
Med13	T	C	11: 86,329,161		probably benign	Het
Myh6	A	T	14: 54,948,347	Y1490*	probably null	Het
Myo10	T	C	15: 25,804,368	L1583P	probably damaging	Het
Nkx6-3	A	G	8: 23,157,706	E227G	possibly damaging	Het
Nlrp1a	T	A	11: 71,114,004		probably benign	Het
Nlrp5-ps	A	C	7: 14,583,091		noncoding transcript	Het
Nup188	T	G	2: 30,326,479	I765S	probably null	Het
Obscn	G	A	11: 59,128,281	A969V	probably benign	Het
Olfr1080	A	T	2: 86,553,779	L115Q	probably damaging	Het
Olfr348	T	A	2: 36,787,440	M305K	probably benign	Het
Olfr76	G	T	19: 12,119,853	D286E	possibly damaging	Het
Olfr96	T	C	17: 37,226,043	L306P	possibly damaging	Het
Otogl	T	A	10: 107,770,650		probably benign	Het
Pcnx3	G	A	19: 5,665,583	R1472W	probably damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plscr4	T	A	9: 92,488,761		probably benign	Het
Pon2	G	A	6: 5,266,156	Q288*	probably null	Het
Ptpn13	C	A	5: 103,533,348	R805S	probably damaging	Het
Pyroxd2	A	T	19: 42,747,553	V62D	probably damaging	Het
Rab37	G	T	11: 115,156,964	C44F	probably damaging	Het
Rbm44	T	C	1: 91,152,347	S52P	probably benign	Het
Rgl3	A	G	9: 21,976,857	W454R	probably damaging	Het
Rita1	A	G	5: 120,609,772	S154P	probably benign	Het
Scn5a	T	C	9: 119,522,599	D772G	probably damaging	Het
Sec23ip	G	A	7: 128,761,405		probably benign	Het
Slc23a1	T	A	18: 35,622,979		probably benign	Het
Sparcl1	T	A	5: 104,089,637	D444V	probably damaging	Het
Taar6	C	A	10: 23,985,148	V167L	probably benign	Het
Tmcc3	T	A	10: 94,578,545	N36K	probably benign	Het
Tmem200c	T	A	17: 68,840,548	V42E	probably damaging	Het
Trhde	T	C	10: 114,502,982		probably benign	Het
Tshz3	A	G	7: 36,770,533	E649G	probably benign	Het
Utp4	T	C	8: 106,898,537		probably benign	Het
Vmn1r30	A	G	6: 58,435,277	V190A	probably benign	Het
Vmn1r35	A	G	6: 66,678,843	I281T	probably damaging	Het
Vmn1r58	G	T	7: 5,410,330	H300Q	probably benign	Het
Vmn1r84	A	G	7: 12,361,872	L286P	probably damaging	Het
Vmn2r54	A	T	7: 12,615,649	C669S	probably damaging	Het
Wdr61	A	T	9: 54,727,578		probably benign	Het
Zfp623	T	C	15: 75,948,661	S489P	probably benign	Het

Other mutations in Col5a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Col5a3	APN	9	20786389	nonsense	probably null
IGL01548:Col5a3	APN	9	20803000	splice site	probably benign
IGL02164:Col5a3	APN	9	20792643	critical splice donor site	probably null
IGL02297:Col5a3	APN	9	20772154	missense	unknown
IGL02333:Col5a3	APN	9	20799306	missense	unknown
IGL02349:Col5a3	APN	9	20772361	missense	unknown
IGL02390:Col5a3	APN	9	20776996	missense	unknown
IGL02685:Col5a3	APN	9	20772205	missense	unknown
IGL02941:Col5a3	APN	9	20804666	missense	unknown
IGL03001:Col5a3	APN	9	20807744	missense	unknown
IGL03061:Col5a3	APN	9	20797572	critical splice donor site	probably null
IGL03102:Col5a3	APN	9	20804635	critical splice donor site	probably null
IGL03308:Col5a3	APN	9	20808379	missense	unknown
IGL03372:Col5a3	APN	9	20775328	missense	unknown
Guppy	UTSW	9	20779033	missense	probably damaging	1.00
minifish	UTSW	9	20785586	missense	probably damaging	0.99
R0002:Col5a3	UTSW	9	20809856	critical splice acceptor site	probably null
R0012:Col5a3	UTSW	9	20777108	splice site	probably benign
R0316:Col5a3	UTSW	9	20775325	missense	unknown
R0357:Col5a3	UTSW	9	20807768	splice site	probably benign
R0483:Col5a3	UTSW	9	20782481	splice site	probably null
R0485:Col5a3	UTSW	9	20782708	missense	probably damaging	0.99
R0627:Col5a3	UTSW	9	20775485	missense	unknown
R1035:Col5a3	UTSW	9	20793499	splice site	probably benign
R1051:Col5a3	UTSW	9	20775235	missense	unknown
R1295:Col5a3	UTSW	9	20808418	missense	unknown
R1438:Col5a3	UTSW	9	20779957	missense	probably damaging	0.99
R1622:Col5a3	UTSW	9	20772220	missense	unknown
R1668:Col5a3	UTSW	9	20771096	missense	unknown
R1680:Col5a3	UTSW	9	20784668	critical splice donor site	probably null
R2112:Col5a3	UTSW	9	20809777	missense	unknown
R2149:Col5a3	UTSW	9	20771270	missense	unknown
R2159:Col5a3	UTSW	9	20771310	missense	unknown
R2939:Col5a3	UTSW	9	20795658	missense	unknown
R3236:Col5a3	UTSW	9	20807653	missense	unknown
R3845:Col5a3	UTSW	9	20808377	missense	unknown
R4598:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4599:Col5a3	UTSW	9	20774559	critical splice donor site	probably null
R4611:Col5a3	UTSW	9	20814896	unclassified	probably benign
R4713:Col5a3	UTSW	9	20793574	missense	unknown
R4723:Col5a3	UTSW	9	20809591	missense	unknown
R5209:Col5a3	UTSW	9	20778643	intron	probably benign
R5336:Col5a3	UTSW	9	20799301	missense	unknown
R5378:Col5a3	UTSW	9	20797576	missense	unknown
R5614:Col5a3	UTSW	9	20783476	splice site	probably benign
R5775:Col5a3	UTSW	9	20801072	missense	unknown
R5895:Col5a3	UTSW	9	20772442	missense	unknown
R6048:Col5a3	UTSW	9	20807619	missense	unknown
R6265:Col5a3	UTSW	9	20793764	missense	unknown
R6372:Col5a3	UTSW	9	20785586	missense	probably damaging	0.99
R6520:Col5a3	UTSW	9	20774052	missense	unknown
R6558:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6608:Col5a3	UTSW	9	20774019	missense	unknown
R6679:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6680:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6696:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6698:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6700:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6708:Col5a3	UTSW	9	20775035	missense	unknown
R6712:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6714:Col5a3	UTSW	9	20779033	missense	probably damaging	1.00
R6828:Col5a3	UTSW	9	20798452	missense	unknown
R7343:Col5a3	UTSW	9	20793946	critical splice donor site	probably null
R7431:Col5a3	UTSW	9	20770835	makesense	probably null
R7500:Col5a3	UTSW	9	20800289	missense	unknown
R7592:Col5a3	UTSW	9	20797393	missense	unknown
R7671:Col5a3	UTSW	9	20775086	critical splice acceptor site	probably null
R7957:Col5a3	UTSW	9	20774051	missense	unknown
R8510:Col5a3	UTSW	9	20793732	missense	unknown
R8979:Col5a3	UTSW	9	20775301	missense	unknown
R9050:Col5a3	UTSW	9	20786395	missense	probably damaging	1.00
R9052:Col5a3	UTSW	9	20799437	missense	unknown
R9072:Col5a3	UTSW	9	20771157	missense	unknown
R9341:Col5a3	UTSW	9	20793613	missense	unknown
R9343:Col5a3	UTSW	9	20793613	missense	unknown
R9529:Col5a3	UTSW	9	20774012	critical splice donor site	probably null
R9562:Col5a3	UTSW	9	20803133	missense	unknown
R9781:Col5a3	UTSW	9	20809976	missense	unknown
Z1177:Col5a3	UTSW	9	20775334	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TATCACGGAAGCAGAGCCAGGCAATC -3'
(R):5'- GGACCATTTGTGGAGTCTGATCTGAGC -3'

Sequencing Primer
(F):5'- AGCCAGGCAATCAGTGC -3'
(R):5'- ctccatctattacccattactctctc -3'

Posted On

2013-04-24