Mutagenetix > Incidental Mutation

Incidental Mutation 'R0360:Otogl'

30058

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

038566-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 107770650 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

AlphaFold

F7A4A7

Predicted Effect

probably benign
Transcript: ENSMUST00000165341

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	G	A	7: 28,611,128		probably benign	Het
Adcyap1r1	G	T	6: 55,475,523		probably benign	Het
Ankrd6	T	C	4: 32,836,424	T44A	probably damaging	Het
Ano7	A	G	1: 93,388,658	D221G	probably benign	Het
Bhlhe40	C	A	6: 108,664,750	N218K	probably damaging	Het
Bms1	A	G	6: 118,405,290	V429A	probably benign	Het
C7	T	A	15: 4,988,962	T800S	probably benign	Het
Camta2	G	A	11: 70,683,310	T127I	probably damaging	Het
Ccdc13	T	A	9: 121,798,216	N665I	probably damaging	Het
Ccdc157	T	C	11: 4,146,663	E362G	probably damaging	Het
Ccdc73	T	A	2: 104,981,007	N310K	probably damaging	Het
Cmklr1	A	T	5: 113,614,517	L141H	probably damaging	Het
Cnst	C	A	1: 179,579,535	A49E	probably benign	Het
Col5a3	C	T	9: 20,772,466	R1498Q	unknown	Het
Crybb3	T	A	5: 113,075,953	I197F	probably damaging	Het
Cryzl1	G	A	16: 91,707,267	P97S	probably benign	Het
Cubn	T	C	2: 13,310,507		probably benign	Het
Cyp2d37-ps	T	C	15: 82,690,052		noncoding transcript	Het
Cyp4a12b	C	A	4: 115,432,920	N223K	probably benign	Het
D16Ertd472e	A	T	16: 78,547,885	C112S	probably benign	Het
Dennd2a	T	C	6: 39,508,299	T349A	probably benign	Het
Dock5	G	A	14: 67,822,680		probably benign	Het
Dpp6	T	C	5: 27,652,269	L404P	probably damaging	Het
Dsc3	T	A	18: 19,971,582	T563S	possibly damaging	Het
Dync2h1	T	A	9: 7,113,182	E214D	possibly damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elmo1	A	T	13: 20,564,493	K503*	probably null	Het
Eng	T	C	2: 32,679,137	S559P	probably benign	Het
Epc2	T	A	2: 49,537,133	V563E	possibly damaging	Het
Fancm	A	G	12: 65,075,950	Y82C	probably damaging	Het
Flt4	A	T	11: 49,636,991	M924L	probably benign	Het
Gabpa	T	A	16: 84,857,387	N317K	possibly damaging	Het
Gchfr	T	G	2: 119,167,846	Y3*	probably null	Het
Gli3	G	T	13: 15,724,764	G912V	probably benign	Het
Gm10295	C	A	7: 71,350,613	C73F	unknown	Het
Gm10382	G	T	5: 125,389,664		probably benign	Het
Gm6614	A	C	6: 141,982,327		probably benign	Het
Gp1ba	T	C	11: 70,640,458		probably benign	Het
Gpr146	G	A	5: 139,379,178		probably benign	Het
Hexdc	T	A	11: 121,212,143	H62Q	probably benign	Het
Hgd	T	A	16: 37,611,184		probably benign	Het
Hs6st1	G	A	1: 36,069,185		probably null	Het
Icam4	A	G	9: 21,029,821	Y123C	probably damaging	Het
Il24	A	G	1: 130,883,937	V134A	probably damaging	Het
Iqcb1	G	T	16: 36,872,308	A562S	probably damaging	Het
Iqgap2	A	C	13: 95,731,275		probably benign	Het
Islr2	T	C	9: 58,199,744	T78A	possibly damaging	Het
Kif1b	A	G	4: 149,262,729	I330T	probably damaging	Het
Kirrel	T	C	3: 87,089,799	Y287C	probably damaging	Het
Klf10	C	T	15: 38,296,846	V317M	probably benign	Het
Klhl9	T	G	4: 88,720,290	K571N	probably benign	Het
Lin37	T	C	7: 30,557,013	I97V	possibly damaging	Het
Lrrc37a	C	T	11: 103,500,640	V1320I	possibly damaging	Het
Lrrc74a	A	G	12: 86,737,795	H99R	probably damaging	Het
Maats1	T	A	16: 38,298,297		probably null	Het
Me3	T	A	7: 89,786,414		probably null	Het
Med13	T	C	11: 86,329,161		probably benign	Het
Myh6	A	T	14: 54,948,347	Y1490*	probably null	Het
Myo10	T	C	15: 25,804,368	L1583P	probably damaging	Het
Nkx6-3	A	G	8: 23,157,706	E227G	possibly damaging	Het
Nlrp1a	T	A	11: 71,114,004		probably benign	Het
Nlrp5-ps	A	C	7: 14,583,091		noncoding transcript	Het
Nup188	T	G	2: 30,326,479	I765S	probably null	Het
Obscn	G	A	11: 59,128,281	A969V	probably benign	Het
Olfr1080	A	T	2: 86,553,779	L115Q	probably damaging	Het
Olfr348	T	A	2: 36,787,440	M305K	probably benign	Het
Olfr76	G	T	19: 12,119,853	D286E	possibly damaging	Het
Olfr96	T	C	17: 37,226,043	L306P	possibly damaging	Het
Pcnx3	G	A	19: 5,665,583	R1472W	probably damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plscr4	T	A	9: 92,488,761		probably benign	Het
Pon2	G	A	6: 5,266,156	Q288*	probably null	Het
Ptpn13	C	A	5: 103,533,348	R805S	probably damaging	Het
Pyroxd2	A	T	19: 42,747,553	V62D	probably damaging	Het
Rab37	G	T	11: 115,156,964	C44F	probably damaging	Het
Rbm44	T	C	1: 91,152,347	S52P	probably benign	Het
Rgl3	A	G	9: 21,976,857	W454R	probably damaging	Het
Rita1	A	G	5: 120,609,772	S154P	probably benign	Het
Scn5a	T	C	9: 119,522,599	D772G	probably damaging	Het
Sec23ip	G	A	7: 128,761,405		probably benign	Het
Slc23a1	T	A	18: 35,622,979		probably benign	Het
Sparcl1	T	A	5: 104,089,637	D444V	probably damaging	Het
Taar6	C	A	10: 23,985,148	V167L	probably benign	Het
Tmcc3	T	A	10: 94,578,545	N36K	probably benign	Het
Tmem200c	T	A	17: 68,840,548	V42E	probably damaging	Het
Trhde	T	C	10: 114,502,982		probably benign	Het
Tshz3	A	G	7: 36,770,533	E649G	probably benign	Het
Utp4	T	C	8: 106,898,537		probably benign	Het
Vmn1r30	A	G	6: 58,435,277	V190A	probably benign	Het
Vmn1r35	A	G	6: 66,678,843	I281T	probably damaging	Het
Vmn1r58	G	T	7: 5,410,330	H300Q	probably benign	Het
Vmn1r84	A	G	7: 12,361,872	L286P	probably damaging	Het
Vmn2r54	A	T	7: 12,615,649	C669S	probably damaging	Het
Wdr61	A	T	9: 54,727,578		probably benign	Het
Zfp623	T	C	15: 75,948,661	S489P	probably benign	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R7988:Otogl	UTSW	10	107895776	missense	probably damaging	1.00
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
R8680:Otogl	UTSW	10	107912075	critical splice donor site	probably null
R9025:Otogl	UTSW	10	107777571	missense	probably damaging	0.99
R9090:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9223:Otogl	UTSW	10	107854344	missense	probably damaging	0.99
R9268:Otogl	UTSW	10	107781056	missense	probably damaging	1.00
R9271:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9356:Otogl	UTSW	10	107782029	missense	probably damaging	1.00
R9484:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R9484:Otogl	UTSW	10	107901295	missense	probably damaging	1.00
R9571:Otogl	UTSW	10	107762503	missense	possibly damaging	0.94
R9731:Otogl	UTSW	10	107899467	missense	probably damaging	1.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GCAGATGTGTGGCAGATGACATTTTC -3'
(R):5'- GAATGCCGACTGGTAGAGGCTAAC -3'

Sequencing Primer
(F):5'- GGCAGATGACATTTTCTACTGTG -3'
(R):5'- AACCTGTACTATATTTCTAACATGGC -3'

Posted On

2013-04-24