Incidental Mutation 'R0360:Lrrc74a'
ID 30062
Institutional Source Beutler Lab
Gene Symbol Lrrc74a
Ensembl Gene ENSMUSG00000059114
Gene Name leucine rich repeat containing 74A
Synonyms Gm6772, Lrrc74
MMRRC Submission 038566-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R0360 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 86781143-86810571 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86784569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 99 (H99R)
Ref Sequence ENSEMBL: ENSMUSP00000152776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095527] [ENSMUST00000222180] [ENSMUST00000223308]
AlphaFold A0A1Y7VMD6
Predicted Effect probably damaging
Transcript: ENSMUST00000095527
AA Change: H99R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093183
Gene: ENSMUSG00000059114
AA Change: H99R

DomainStartEndE-ValueType
Blast:LRR 87 116 9e-7 BLAST
LRR 117 144 4.17e-3 SMART
LRR 145 172 3.16e-3 SMART
LRR 174 201 1.92e-2 SMART
LRR 202 229 3.07e-1 SMART
LRR 230 257 1.03e-2 SMART
LRR 258 285 1.64e-1 SMART
LRR 286 313 2.03e0 SMART
LRR 314 341 1.11e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222180
AA Change: H99R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223197
Predicted Effect probably damaging
Transcript: ENSMUST00000223308
AA Change: H99R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2666 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,310,553 (GRCm39) probably benign Het
Adcyap1r1 G T 6: 55,452,508 (GRCm39) probably benign Het
Ankrd6 T C 4: 32,836,424 (GRCm39) T44A probably damaging Het
Ano7 A G 1: 93,316,380 (GRCm39) D221G probably benign Het
Bhlhe40 C A 6: 108,641,711 (GRCm39) N218K probably damaging Het
Bms1 A G 6: 118,382,251 (GRCm39) V429A probably benign Het
C7 T A 15: 5,018,444 (GRCm39) T800S probably benign Het
Camta2 G A 11: 70,574,136 (GRCm39) T127I probably damaging Het
Ccdc13 T A 9: 121,627,282 (GRCm39) N665I probably damaging Het
Ccdc157 T C 11: 4,096,663 (GRCm39) E362G probably damaging Het
Ccdc73 T A 2: 104,811,352 (GRCm39) N310K probably damaging Het
Cfap91 T A 16: 38,118,659 (GRCm39) probably null Het
Cmklr1 A T 5: 113,752,578 (GRCm39) L141H probably damaging Het
Cnst C A 1: 179,407,100 (GRCm39) A49E probably benign Het
Col5a3 C T 9: 20,683,762 (GRCm39) R1498Q unknown Het
Crybb3 T A 5: 113,223,819 (GRCm39) I197F probably damaging Het
Cryzl1 G A 16: 91,504,155 (GRCm39) P97S probably benign Het
Cubn T C 2: 13,315,318 (GRCm39) probably benign Het
Cyp2d37-ps T C 15: 82,574,253 (GRCm39) noncoding transcript Het
Cyp4a12b C A 4: 115,290,117 (GRCm39) N223K probably benign Het
D16Ertd472e A T 16: 78,344,773 (GRCm39) C112S probably benign Het
Dennd2a T C 6: 39,485,233 (GRCm39) T349A probably benign Het
Dock5 G A 14: 68,060,129 (GRCm39) probably benign Het
Dpp6 T C 5: 27,857,267 (GRCm39) L404P probably damaging Het
Dsc3 T A 18: 20,104,639 (GRCm39) T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 (GRCm39) E214D possibly damaging Het
Elac2 A G 11: 64,870,136 (GRCm39) Y67C probably damaging Het
Elmo1 A T 13: 20,748,663 (GRCm39) K503* probably null Het
Eng T C 2: 32,569,149 (GRCm39) S559P probably benign Het
Epc2 T A 2: 49,427,145 (GRCm39) V563E possibly damaging Het
Fancm A G 12: 65,122,724 (GRCm39) Y82C probably damaging Het
Flt4 A T 11: 49,527,818 (GRCm39) M924L probably benign Het
Gabpa T A 16: 84,654,275 (GRCm39) N317K possibly damaging Het
Gchfr T G 2: 118,998,327 (GRCm39) Y3* probably null Het
Gli3 G T 13: 15,899,349 (GRCm39) G912V probably benign Het
Gm10295 C A 7: 71,000,361 (GRCm39) C73F unknown Het
Gm10382 G T 5: 125,466,728 (GRCm39) probably benign Het
Gp1ba T C 11: 70,531,284 (GRCm39) probably benign Het
Gpr146 G A 5: 139,364,933 (GRCm39) probably benign Het
Hexd T A 11: 121,102,969 (GRCm39) H62Q probably benign Het
Hgd T A 16: 37,431,546 (GRCm39) probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Icam4 A G 9: 20,941,117 (GRCm39) Y123C probably damaging Het
Il24 A G 1: 130,811,674 (GRCm39) V134A probably damaging Het
Iqcb1 G T 16: 36,692,670 (GRCm39) A562S probably damaging Het
Iqgap2 A C 13: 95,867,783 (GRCm39) probably benign Het
Islr2 T C 9: 58,107,027 (GRCm39) T78A possibly damaging Het
Kif1b A G 4: 149,347,186 (GRCm39) I330T probably damaging Het
Kirrel1 T C 3: 86,997,106 (GRCm39) Y287C probably damaging Het
Klf10 C T 15: 38,297,090 (GRCm39) V317M probably benign Het
Klhl9 T G 4: 88,638,527 (GRCm39) K571N probably benign Het
Lin37 T C 7: 30,256,438 (GRCm39) I97V possibly damaging Het
Lrrc37a C T 11: 103,391,466 (GRCm39) V1320I possibly damaging Het
Me3 T A 7: 89,435,622 (GRCm39) probably null Het
Med13 T C 11: 86,219,987 (GRCm39) probably benign Het
Myh6 A T 14: 55,185,804 (GRCm39) Y1490* probably null Het
Myo10 T C 15: 25,804,454 (GRCm39) L1583P probably damaging Het
Nkx6-3 A G 8: 23,647,722 (GRCm39) E227G possibly damaging Het
Nlrp1a T A 11: 71,004,830 (GRCm39) probably benign Het
Nlrp5-ps A C 7: 14,317,016 (GRCm39) noncoding transcript Het
Nup188 T G 2: 30,216,491 (GRCm39) I765S probably null Het
Obscn G A 11: 59,019,107 (GRCm39) A969V probably benign Het
Or11a4 T C 17: 37,536,934 (GRCm39) L306P possibly damaging Het
Or1j19 T A 2: 36,677,452 (GRCm39) M305K probably benign Het
Or5a1 G T 19: 12,097,217 (GRCm39) D286E possibly damaging Het
Or8k33 A T 2: 86,384,123 (GRCm39) L115Q probably damaging Het
Otogl T A 10: 107,606,511 (GRCm39) probably benign Het
Pcnx3 G A 19: 5,715,611 (GRCm39) R1472W probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Plscr4 T A 9: 92,370,814 (GRCm39) probably benign Het
Pon2 G A 6: 5,266,156 (GRCm39) Q288* probably null Het
Ptpn13 C A 5: 103,681,214 (GRCm39) R805S probably damaging Het
Pyroxd2 A T 19: 42,735,992 (GRCm39) V62D probably damaging Het
Rab37 G T 11: 115,047,790 (GRCm39) C44F probably damaging Het
Rbm44 T C 1: 91,080,069 (GRCm39) S52P probably benign Het
Rgl3 A G 9: 21,888,153 (GRCm39) W454R probably damaging Het
Rita1 A G 5: 120,747,837 (GRCm39) S154P probably benign Het
Scn5a T C 9: 119,351,665 (GRCm39) D772G probably damaging Het
Sec23ip G A 7: 128,363,129 (GRCm39) probably benign Het
Skic8 A T 9: 54,634,862 (GRCm39) probably benign Het
Slc23a1 T A 18: 35,756,032 (GRCm39) probably benign Het
Slco1a8 A C 6: 141,928,053 (GRCm39) probably benign Het
Sparcl1 T A 5: 104,237,503 (GRCm39) D444V probably damaging Het
Taar6 C A 10: 23,861,046 (GRCm39) V167L probably benign Het
Tmcc3 T A 10: 94,414,407 (GRCm39) N36K probably benign Het
Tmem200c T A 17: 69,147,543 (GRCm39) V42E probably damaging Het
Trhde T C 10: 114,338,887 (GRCm39) probably benign Het
Tshz3 A G 7: 36,469,958 (GRCm39) E649G probably benign Het
Utp4 T C 8: 107,625,169 (GRCm39) probably benign Het
Vmn1r30 A G 6: 58,412,262 (GRCm39) V190A probably benign Het
Vmn1r35 A G 6: 66,655,827 (GRCm39) I281T probably damaging Het
Vmn1r58 G T 7: 5,413,329 (GRCm39) H300Q probably benign Het
Vmn1r84 A G 7: 12,095,799 (GRCm39) L286P probably damaging Het
Vmn2r54 A T 7: 12,349,576 (GRCm39) C669S probably damaging Het
Zfp623 T C 15: 75,820,510 (GRCm39) S489P probably benign Het
Other mutations in Lrrc74a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Lrrc74a APN 12 86,801,204 (GRCm39) missense probably damaging 1.00
IGL01380:Lrrc74a APN 12 86,808,496 (GRCm39) missense possibly damaging 0.62
IGL01715:Lrrc74a APN 12 86,801,189 (GRCm39) missense probably benign 0.05
IGL01832:Lrrc74a APN 12 86,808,488 (GRCm39) missense probably benign 0.00
IGL01953:Lrrc74a APN 12 86,788,494 (GRCm39) missense probably damaging 1.00
IGL02218:Lrrc74a APN 12 86,795,822 (GRCm39) missense probably benign 0.15
IGL02637:Lrrc74a APN 12 86,788,521 (GRCm39) nonsense probably null
IGL03397:Lrrc74a APN 12 86,805,312 (GRCm39) missense probably benign 0.39
R0201:Lrrc74a UTSW 12 86,808,547 (GRCm39) splice site probably benign
R0403:Lrrc74a UTSW 12 86,787,753 (GRCm39) missense probably damaging 1.00
R0729:Lrrc74a UTSW 12 86,792,353 (GRCm39) nonsense probably null
R1675:Lrrc74a UTSW 12 86,787,800 (GRCm39) missense probably damaging 1.00
R1774:Lrrc74a UTSW 12 86,795,827 (GRCm39) missense probably damaging 1.00
R1818:Lrrc74a UTSW 12 86,784,484 (GRCm39) missense probably damaging 1.00
R4688:Lrrc74a UTSW 12 86,784,472 (GRCm39) nonsense probably null
R6023:Lrrc74a UTSW 12 86,805,380 (GRCm39) missense probably damaging 1.00
R6190:Lrrc74a UTSW 12 86,783,263 (GRCm39) missense probably benign 0.01
R6226:Lrrc74a UTSW 12 86,795,231 (GRCm39) missense possibly damaging 0.87
R6247:Lrrc74a UTSW 12 86,805,330 (GRCm39) missense probably damaging 1.00
R7275:Lrrc74a UTSW 12 86,787,753 (GRCm39) missense probably damaging 1.00
R7631:Lrrc74a UTSW 12 86,795,884 (GRCm39) missense probably damaging 1.00
R7857:Lrrc74a UTSW 12 86,788,485 (GRCm39) missense probably benign 0.00
R8172:Lrrc74a UTSW 12 86,788,530 (GRCm39) missense probably damaging 1.00
R8715:Lrrc74a UTSW 12 86,805,239 (GRCm39) missense probably damaging 1.00
R8717:Lrrc74a UTSW 12 86,783,253 (GRCm39) missense probably damaging 0.99
R9080:Lrrc74a UTSW 12 86,795,908 (GRCm39) missense possibly damaging 0.87
R9612:Lrrc74a UTSW 12 86,805,345 (GRCm39) missense possibly damaging 0.84
X0024:Lrrc74a UTSW 12 86,795,819 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCAGGCAAAGTGCATGTCC -3'
(R):5'- GGCTGATGACTTGCTTCCTGACTG -3'

Sequencing Primer
(F):5'- AAAGTGCATGTCCCCTGG -3'
(R):5'- CTGGGAAAGGACACTGTCTTC -3'
Posted On 2013-04-24