Incidental Mutation 'R0360:Iqcb1'
ID 30066
Institutional Source Beutler Lab
Gene Symbol Iqcb1
Ensembl Gene ENSMUSG00000022837
Gene Name IQ calmodulin-binding motif containing 1
Synonyms 6820449I09Rik, NPHP5
MMRRC Submission 038566-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.342) question?
Stock # R0360 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 36648747-36693083 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 36692670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 562 (A562S)
Ref Sequence ENSEMBL: ENSMUSP00000023535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023534] [ENSMUST00000023535] [ENSMUST00000075946] [ENSMUST00000114812] [ENSMUST00000114819] [ENSMUST00000134616] [ENSMUST00000135406]
AlphaFold Q8BP00
Predicted Effect probably benign
Transcript: ENSMUST00000023534
SMART Domains Protein: ENSMUSP00000023534
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
low complexity region 55 99 N/A INTRINSIC
low complexity region 109 126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000023535
AA Change: A562S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023535
Gene: ENSMUSG00000022837
AA Change: A562S

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075946
SMART Domains Protein: ENSMUSP00000075331
Gene: ENSMUSG00000022838

DomainStartEndE-ValueType
low complexity region 44 71 N/A INTRINSIC
low complexity region 117 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114812
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114819
SMART Domains Protein: ENSMUSP00000110467
Gene: ENSMUSG00000022837

DomainStartEndE-ValueType
IQ 293 315 5.92e-4 SMART
low complexity region 341 358 N/A INTRINSIC
IQ 386 408 2.66e-6 SMART
low complexity region 428 442 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134556
Predicted Effect probably benign
Transcript: ENSMUST00000134616
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135406
SMART Domains Protein: ENSMUSP00000115848
Gene: ENSMUSG00000034243

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Meta Mutation Damage Score 0.1593 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nephrocystin protein that interacts with calmodulin and the retinitis pigmentosa GTPase regulator protein. The encoded protein has a central coiled-coil region and two calmodulin-binding IQ domains. It is localized to the primary cilia of renal epithelial cells and connecting cilia of photoreceptor cells. The protein is thought to play a role in ciliary function. Defects in this gene result in Senior-Loken syndrome type 5. Alternative splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,310,553 (GRCm39) probably benign Het
Adcyap1r1 G T 6: 55,452,508 (GRCm39) probably benign Het
Ankrd6 T C 4: 32,836,424 (GRCm39) T44A probably damaging Het
Ano7 A G 1: 93,316,380 (GRCm39) D221G probably benign Het
Bhlhe40 C A 6: 108,641,711 (GRCm39) N218K probably damaging Het
Bms1 A G 6: 118,382,251 (GRCm39) V429A probably benign Het
C7 T A 15: 5,018,444 (GRCm39) T800S probably benign Het
Camta2 G A 11: 70,574,136 (GRCm39) T127I probably damaging Het
Ccdc13 T A 9: 121,627,282 (GRCm39) N665I probably damaging Het
Ccdc157 T C 11: 4,096,663 (GRCm39) E362G probably damaging Het
Ccdc73 T A 2: 104,811,352 (GRCm39) N310K probably damaging Het
Cfap91 T A 16: 38,118,659 (GRCm39) probably null Het
Cmklr1 A T 5: 113,752,578 (GRCm39) L141H probably damaging Het
Cnst C A 1: 179,407,100 (GRCm39) A49E probably benign Het
Col5a3 C T 9: 20,683,762 (GRCm39) R1498Q unknown Het
Crybb3 T A 5: 113,223,819 (GRCm39) I197F probably damaging Het
Cryzl1 G A 16: 91,504,155 (GRCm39) P97S probably benign Het
Cubn T C 2: 13,315,318 (GRCm39) probably benign Het
Cyp2d37-ps T C 15: 82,574,253 (GRCm39) noncoding transcript Het
Cyp4a12b C A 4: 115,290,117 (GRCm39) N223K probably benign Het
D16Ertd472e A T 16: 78,344,773 (GRCm39) C112S probably benign Het
Dennd2a T C 6: 39,485,233 (GRCm39) T349A probably benign Het
Dock5 G A 14: 68,060,129 (GRCm39) probably benign Het
Dpp6 T C 5: 27,857,267 (GRCm39) L404P probably damaging Het
Dsc3 T A 18: 20,104,639 (GRCm39) T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 (GRCm39) E214D possibly damaging Het
Elac2 A G 11: 64,870,136 (GRCm39) Y67C probably damaging Het
Elmo1 A T 13: 20,748,663 (GRCm39) K503* probably null Het
Eng T C 2: 32,569,149 (GRCm39) S559P probably benign Het
Epc2 T A 2: 49,427,145 (GRCm39) V563E possibly damaging Het
Fancm A G 12: 65,122,724 (GRCm39) Y82C probably damaging Het
Flt4 A T 11: 49,527,818 (GRCm39) M924L probably benign Het
Gabpa T A 16: 84,654,275 (GRCm39) N317K possibly damaging Het
Gchfr T G 2: 118,998,327 (GRCm39) Y3* probably null Het
Gli3 G T 13: 15,899,349 (GRCm39) G912V probably benign Het
Gm10295 C A 7: 71,000,361 (GRCm39) C73F unknown Het
Gm10382 G T 5: 125,466,728 (GRCm39) probably benign Het
Gp1ba T C 11: 70,531,284 (GRCm39) probably benign Het
Gpr146 G A 5: 139,364,933 (GRCm39) probably benign Het
Hexd T A 11: 121,102,969 (GRCm39) H62Q probably benign Het
Hgd T A 16: 37,431,546 (GRCm39) probably benign Het
Hs6st1 G A 1: 36,108,266 (GRCm39) probably null Het
Icam4 A G 9: 20,941,117 (GRCm39) Y123C probably damaging Het
Il24 A G 1: 130,811,674 (GRCm39) V134A probably damaging Het
Iqgap2 A C 13: 95,867,783 (GRCm39) probably benign Het
Islr2 T C 9: 58,107,027 (GRCm39) T78A possibly damaging Het
Kif1b A G 4: 149,347,186 (GRCm39) I330T probably damaging Het
Kirrel1 T C 3: 86,997,106 (GRCm39) Y287C probably damaging Het
Klf10 C T 15: 38,297,090 (GRCm39) V317M probably benign Het
Klhl9 T G 4: 88,638,527 (GRCm39) K571N probably benign Het
Lin37 T C 7: 30,256,438 (GRCm39) I97V possibly damaging Het
Lrrc37a C T 11: 103,391,466 (GRCm39) V1320I possibly damaging Het
Lrrc74a A G 12: 86,784,569 (GRCm39) H99R probably damaging Het
Me3 T A 7: 89,435,622 (GRCm39) probably null Het
Med13 T C 11: 86,219,987 (GRCm39) probably benign Het
Myh6 A T 14: 55,185,804 (GRCm39) Y1490* probably null Het
Myo10 T C 15: 25,804,454 (GRCm39) L1583P probably damaging Het
Nkx6-3 A G 8: 23,647,722 (GRCm39) E227G possibly damaging Het
Nlrp1a T A 11: 71,004,830 (GRCm39) probably benign Het
Nlrp5-ps A C 7: 14,317,016 (GRCm39) noncoding transcript Het
Nup188 T G 2: 30,216,491 (GRCm39) I765S probably null Het
Obscn G A 11: 59,019,107 (GRCm39) A969V probably benign Het
Or11a4 T C 17: 37,536,934 (GRCm39) L306P possibly damaging Het
Or1j19 T A 2: 36,677,452 (GRCm39) M305K probably benign Het
Or5a1 G T 19: 12,097,217 (GRCm39) D286E possibly damaging Het
Or8k33 A T 2: 86,384,123 (GRCm39) L115Q probably damaging Het
Otogl T A 10: 107,606,511 (GRCm39) probably benign Het
Pcnx3 G A 19: 5,715,611 (GRCm39) R1472W probably damaging Het
Plekha5 G A 6: 140,537,473 (GRCm39) R646K possibly damaging Het
Plscr4 T A 9: 92,370,814 (GRCm39) probably benign Het
Pon2 G A 6: 5,266,156 (GRCm39) Q288* probably null Het
Ptpn13 C A 5: 103,681,214 (GRCm39) R805S probably damaging Het
Pyroxd2 A T 19: 42,735,992 (GRCm39) V62D probably damaging Het
Rab37 G T 11: 115,047,790 (GRCm39) C44F probably damaging Het
Rbm44 T C 1: 91,080,069 (GRCm39) S52P probably benign Het
Rgl3 A G 9: 21,888,153 (GRCm39) W454R probably damaging Het
Rita1 A G 5: 120,747,837 (GRCm39) S154P probably benign Het
Scn5a T C 9: 119,351,665 (GRCm39) D772G probably damaging Het
Sec23ip G A 7: 128,363,129 (GRCm39) probably benign Het
Skic8 A T 9: 54,634,862 (GRCm39) probably benign Het
Slc23a1 T A 18: 35,756,032 (GRCm39) probably benign Het
Slco1a8 A C 6: 141,928,053 (GRCm39) probably benign Het
Sparcl1 T A 5: 104,237,503 (GRCm39) D444V probably damaging Het
Taar6 C A 10: 23,861,046 (GRCm39) V167L probably benign Het
Tmcc3 T A 10: 94,414,407 (GRCm39) N36K probably benign Het
Tmem200c T A 17: 69,147,543 (GRCm39) V42E probably damaging Het
Trhde T C 10: 114,338,887 (GRCm39) probably benign Het
Tshz3 A G 7: 36,469,958 (GRCm39) E649G probably benign Het
Utp4 T C 8: 107,625,169 (GRCm39) probably benign Het
Vmn1r30 A G 6: 58,412,262 (GRCm39) V190A probably benign Het
Vmn1r35 A G 6: 66,655,827 (GRCm39) I281T probably damaging Het
Vmn1r58 G T 7: 5,413,329 (GRCm39) H300Q probably benign Het
Vmn1r84 A G 7: 12,095,799 (GRCm39) L286P probably damaging Het
Vmn2r54 A T 7: 12,349,576 (GRCm39) C669S probably damaging Het
Zfp623 T C 15: 75,820,510 (GRCm39) S489P probably benign Het
Other mutations in Iqcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Iqcb1 APN 16 36,678,948 (GRCm39) missense probably benign 0.04
IGL00539:Iqcb1 APN 16 36,678,873 (GRCm39) missense probably damaging 1.00
IGL00763:Iqcb1 APN 16 36,676,649 (GRCm39) splice site probably benign
IGL02247:Iqcb1 APN 16 36,660,258 (GRCm39) missense probably benign 0.34
IGL02444:Iqcb1 APN 16 36,652,273 (GRCm39) nonsense probably null
R1893:Iqcb1 UTSW 16 36,652,245 (GRCm39) missense probably damaging 1.00
R2220:Iqcb1 UTSW 16 36,663,824 (GRCm39) splice site probably null
R2332:Iqcb1 UTSW 16 36,663,801 (GRCm39) missense possibly damaging 0.50
R3833:Iqcb1 UTSW 16 36,652,276 (GRCm39) nonsense probably null
R4841:Iqcb1 UTSW 16 36,655,952 (GRCm39) missense probably benign 0.00
R4842:Iqcb1 UTSW 16 36,655,952 (GRCm39) missense probably benign 0.00
R6574:Iqcb1 UTSW 16 36,691,863 (GRCm39) missense probably damaging 1.00
R6612:Iqcb1 UTSW 16 36,692,023 (GRCm39) unclassified probably benign
R6715:Iqcb1 UTSW 16 36,655,991 (GRCm39) missense probably damaging 0.98
R6939:Iqcb1 UTSW 16 36,660,274 (GRCm39) missense possibly damaging 0.80
R7620:Iqcb1 UTSW 16 36,676,772 (GRCm39) missense probably benign
R7716:Iqcb1 UTSW 16 36,687,969 (GRCm39) missense probably benign
R8247:Iqcb1 UTSW 16 36,678,836 (GRCm39) missense probably benign 0.34
R8976:Iqcb1 UTSW 16 36,692,005 (GRCm39) missense probably benign 0.03
R9081:Iqcb1 UTSW 16 36,656,006 (GRCm39) missense probably null 0.98
R9404:Iqcb1 UTSW 16 36,671,632 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTAGAACCCTGTCCTGTCCTG -3'
(R):5'- TGAAGATGATGCTCTGGAAAGCCAC -3'

Sequencing Primer
(F):5'- cctgtcctgtcctgactataaac -3'
(R):5'- TCTGGAAAGCCACTGGCATAG -3'
Posted On 2013-04-24