Incidental Mutation 'R0360:Hgd'
ID30067
Institutional Source Beutler Lab
Gene Symbol Hgd
Ensembl Gene ENSMUSG00000022821
Gene Namehomogentisate 1, 2-dioxygenase
Synonyms
MMRRC Submission 038566-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0360 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37580153-37632020 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 37611184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159787] [ENSMUST00000160847]
Predicted Effect probably benign
Transcript: ENSMUST00000159787
Predicted Effect probably benign
Transcript: ENSMUST00000160847
SMART Domains Protein: ENSMUSP00000125492
Gene: ENSMUSG00000022821

DomainStartEndE-ValueType
Pfam:HgmA 5 434 2e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162918
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in high levels of urinary homogentisic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dpp6 T C 5: 27,652,269 L404P probably damaging Het
Dsc3 T A 18: 19,971,582 T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fancm A G 12: 65,075,950 Y82C probably damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Il24 A G 1: 130,883,937 V134A probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Pcnx3 G A 19: 5,665,583 R1472W probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Sparcl1 T A 5: 104,089,637 D444V probably damaging Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Vmn2r54 A T 7: 12,615,649 C669S probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Hgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hgd APN 16 37613249 missense probably damaging 1.00
IGL00851:Hgd APN 16 37631695 missense probably damaging 0.98
IGL01339:Hgd APN 16 37631730 missense possibly damaging 0.72
IGL01627:Hgd APN 16 37621925 missense probably damaging 0.96
IGL02565:Hgd APN 16 37615387 missense possibly damaging 0.88
IGL03098:Hgd UTSW 16 37616245 missense probably benign 0.44
R0346:Hgd UTSW 16 37588774 splice site probably benign
R0426:Hgd UTSW 16 37588685 splice site probably benign
R0799:Hgd UTSW 16 37628609 splice site probably benign
R1178:Hgd UTSW 16 37615394 missense possibly damaging 0.95
R2921:Hgd UTSW 16 37618968 missense probably damaging 1.00
R2922:Hgd UTSW 16 37618968 missense probably damaging 1.00
R4791:Hgd UTSW 16 37631825 makesense probably null
R4859:Hgd UTSW 16 37588749 missense probably damaging 1.00
R5289:Hgd UTSW 16 37628551 missense possibly damaging 0.94
R5368:Hgd UTSW 16 37589751 missense probably benign 0.33
R5779:Hgd UTSW 16 37593371 missense probably benign 0.01
R6140:Hgd UTSW 16 37589713 missense probably benign 0.04
R6160:Hgd UTSW 16 37613298 missense probably damaging 1.00
R6636:Hgd UTSW 16 37615374 missense possibly damaging 0.75
R7196:Hgd UTSW 16 37588716 missense probably benign 0.03
R7450:Hgd UTSW 16 37624324 missense possibly damaging 0.88
R7580:Hgd UTSW 16 37618879 missense possibly damaging 0.67
R7720:Hgd UTSW 16 37593435 missense probably benign
Z1177:Hgd UTSW 16 37589719 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGAGCAGTTGTCTGTCTTCTCCTG -3'
(R):5'- CGTTCTAACCCAGAAAAGAGGCACTTG -3'

Sequencing Primer
(F):5'- TGTCTTCTCCTGTGTAACTGAATC -3'
(R):5'- GAAGGGAATTTACCCTCATTGGC -3'
Posted On2013-04-24