Mutagenetix > Incidental Mutation

Incidental Mutation 'R0360:Dsc3'

30070

Institutional Source

Beutler Lab

Gene Symbol

Dsc3

Ensembl Gene

ENSMUSG00000059898

Gene Name

desmocollin 3

Synonyms

MMRRC Submission

038566-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0360 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19960930-20002351 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 19971582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 563 (T563S)

Ref Sequence

ENSEMBL: ENSMUSP00000153261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]

AlphaFold

P55850

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115848
AA Change: T563S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: T563S

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	9.08e-41	SMART
CA	156	241	4.99e-11	SMART
CA	265	353	7.79e-22	SMART
CA	376	471	2.66e-6	SMART
CA	494	576	4.58e-19	SMART
CA	595	677	3.02e-2	SMART
transmembrane domain	692	714	N/A	INTRINSIC
Pfam:Cadherin_C	778	895	1.1e-8	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000225110
AA Change: T563S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)

Meta Mutation Damage Score

0.0640

Coding Region Coverage

1x: 99.2%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

98% (93/95)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp7	G	A	7: 28,611,128		probably benign	Het
Adcyap1r1	G	T	6: 55,475,523		probably benign	Het
Ankrd6	T	C	4: 32,836,424	T44A	probably damaging	Het
Ano7	A	G	1: 93,388,658	D221G	probably benign	Het
Bhlhe40	C	A	6: 108,664,750	N218K	probably damaging	Het
Bms1	A	G	6: 118,405,290	V429A	probably benign	Het
C7	T	A	15: 4,988,962	T800S	probably benign	Het
Camta2	G	A	11: 70,683,310	T127I	probably damaging	Het
Ccdc13	T	A	9: 121,798,216	N665I	probably damaging	Het
Ccdc157	T	C	11: 4,146,663	E362G	probably damaging	Het
Ccdc73	T	A	2: 104,981,007	N310K	probably damaging	Het
Cmklr1	A	T	5: 113,614,517	L141H	probably damaging	Het
Cnst	C	A	1: 179,579,535	A49E	probably benign	Het
Col5a3	C	T	9: 20,772,466	R1498Q	unknown	Het
Crybb3	T	A	5: 113,075,953	I197F	probably damaging	Het
Cryzl1	G	A	16: 91,707,267	P97S	probably benign	Het
Cubn	T	C	2: 13,310,507		probably benign	Het
Cyp2d37-ps	T	C	15: 82,690,052		noncoding transcript	Het
Cyp4a12b	C	A	4: 115,432,920	N223K	probably benign	Het
D16Ertd472e	A	T	16: 78,547,885	C112S	probably benign	Het
Dennd2a	T	C	6: 39,508,299	T349A	probably benign	Het
Dock5	G	A	14: 67,822,680		probably benign	Het
Dpp6	T	C	5: 27,652,269	L404P	probably damaging	Het
Dync2h1	T	A	9: 7,113,182	E214D	possibly damaging	Het
Elac2	A	G	11: 64,979,310	Y67C	probably damaging	Het
Elmo1	A	T	13: 20,564,493	K503*	probably null	Het
Eng	T	C	2: 32,679,137	S559P	probably benign	Het
Epc2	T	A	2: 49,537,133	V563E	possibly damaging	Het
Fancm	A	G	12: 65,075,950	Y82C	probably damaging	Het
Flt4	A	T	11: 49,636,991	M924L	probably benign	Het
Gabpa	T	A	16: 84,857,387	N317K	possibly damaging	Het
Gchfr	T	G	2: 119,167,846	Y3*	probably null	Het
Gli3	G	T	13: 15,724,764	G912V	probably benign	Het
Gm10295	C	A	7: 71,350,613	C73F	unknown	Het
Gm10382	G	T	5: 125,389,664		probably benign	Het
Gm6614	A	C	6: 141,982,327		probably benign	Het
Gp1ba	T	C	11: 70,640,458		probably benign	Het
Gpr146	G	A	5: 139,379,178		probably benign	Het
Hexdc	T	A	11: 121,212,143	H62Q	probably benign	Het
Hgd	T	A	16: 37,611,184		probably benign	Het
Hs6st1	G	A	1: 36,069,185		probably null	Het
Icam4	A	G	9: 21,029,821	Y123C	probably damaging	Het
Il24	A	G	1: 130,883,937	V134A	probably damaging	Het
Iqcb1	G	T	16: 36,872,308	A562S	probably damaging	Het
Iqgap2	A	C	13: 95,731,275		probably benign	Het
Islr2	T	C	9: 58,199,744	T78A	possibly damaging	Het
Kif1b	A	G	4: 149,262,729	I330T	probably damaging	Het
Kirrel	T	C	3: 87,089,799	Y287C	probably damaging	Het
Klf10	C	T	15: 38,296,846	V317M	probably benign	Het
Klhl9	T	G	4: 88,720,290	K571N	probably benign	Het
Lin37	T	C	7: 30,557,013	I97V	possibly damaging	Het
Lrrc37a	C	T	11: 103,500,640	V1320I	possibly damaging	Het
Lrrc74a	A	G	12: 86,737,795	H99R	probably damaging	Het
Maats1	T	A	16: 38,298,297		probably null	Het
Me3	T	A	7: 89,786,414		probably null	Het
Med13	T	C	11: 86,329,161		probably benign	Het
Myh6	A	T	14: 54,948,347	Y1490*	probably null	Het
Myo10	T	C	15: 25,804,368	L1583P	probably damaging	Het
Nkx6-3	A	G	8: 23,157,706	E227G	possibly damaging	Het
Nlrp1a	T	A	11: 71,114,004		probably benign	Het
Nlrp5-ps	A	C	7: 14,583,091		noncoding transcript	Het
Nup188	T	G	2: 30,326,479	I765S	probably null	Het
Obscn	G	A	11: 59,128,281	A969V	probably benign	Het
Olfr1080	A	T	2: 86,553,779	L115Q	probably damaging	Het
Olfr348	T	A	2: 36,787,440	M305K	probably benign	Het
Olfr76	G	T	19: 12,119,853	D286E	possibly damaging	Het
Olfr96	T	C	17: 37,226,043	L306P	possibly damaging	Het
Otogl	T	A	10: 107,770,650		probably benign	Het
Pcnx3	G	A	19: 5,665,583	R1472W	probably damaging	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plscr4	T	A	9: 92,488,761		probably benign	Het
Pon2	G	A	6: 5,266,156	Q288*	probably null	Het
Ptpn13	C	A	5: 103,533,348	R805S	probably damaging	Het
Pyroxd2	A	T	19: 42,747,553	V62D	probably damaging	Het
Rab37	G	T	11: 115,156,964	C44F	probably damaging	Het
Rbm44	T	C	1: 91,152,347	S52P	probably benign	Het
Rgl3	A	G	9: 21,976,857	W454R	probably damaging	Het
Rita1	A	G	5: 120,609,772	S154P	probably benign	Het
Scn5a	T	C	9: 119,522,599	D772G	probably damaging	Het
Sec23ip	G	A	7: 128,761,405		probably benign	Het
Slc23a1	T	A	18: 35,622,979		probably benign	Het
Sparcl1	T	A	5: 104,089,637	D444V	probably damaging	Het
Taar6	C	A	10: 23,985,148	V167L	probably benign	Het
Tmcc3	T	A	10: 94,578,545	N36K	probably benign	Het
Tmem200c	T	A	17: 68,840,548	V42E	probably damaging	Het
Trhde	T	C	10: 114,502,982		probably benign	Het
Tshz3	A	G	7: 36,770,533	E649G	probably benign	Het
Utp4	T	C	8: 106,898,537		probably benign	Het
Vmn1r30	A	G	6: 58,435,277	V190A	probably benign	Het
Vmn1r35	A	G	6: 66,678,843	I281T	probably damaging	Het
Vmn1r58	G	T	7: 5,410,330	H300Q	probably benign	Het
Vmn1r84	A	G	7: 12,361,872	L286P	probably damaging	Het
Vmn2r54	A	T	7: 12,615,649	C669S	probably damaging	Het
Wdr61	A	T	9: 54,727,578		probably benign	Het
Zfp623	T	C	15: 75,948,661	S489P	probably benign	Het

Other mutations in Dsc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Dsc3	APN	18	19985631	missense	probably null	1.00
IGL01978:Dsc3	APN	18	19974196	missense	possibly damaging	0.79
IGL02101:Dsc3	APN	18	20001906	missense	probably benign	0.01
IGL02165:Dsc3	APN	18	19983652	missense	probably benign	0.06
IGL02543:Dsc3	APN	18	19965828	missense	probably benign	0.11
IGL02970:Dsc3	APN	18	19968260	missense	probably damaging	1.00
IGL03097:Dsc3	UTSW	18	19974048	missense	probably benign	0.30
R0133:Dsc3	UTSW	18	19971582	missense	probably damaging	0.96
R0304:Dsc3	UTSW	18	19981241	missense	probably damaging	1.00
R0673:Dsc3	UTSW	18	19989590	missense	probably damaging	1.00
R0826:Dsc3	UTSW	18	19981172	missense	probably damaging	0.99
R1120:Dsc3	UTSW	18	19986977	missense	probably benign	0.05
R1491:Dsc3	UTSW	18	19987034	missense	probably damaging	0.99
R1667:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R1688:Dsc3	UTSW	18	19966227	missense	probably damaging	1.00
R1792:Dsc3	UTSW	18	19986998	missense	probably damaging	1.00
R1858:Dsc3	UTSW	18	19965716	missense	probably damaging	0.97
R1965:Dsc3	UTSW	18	19980672	missense	probably damaging	1.00
R1988:Dsc3	UTSW	18	19965846	missense	possibly damaging	0.86
R2049:Dsc3	UTSW	18	19989680	missense	possibly damaging	0.65
R2127:Dsc3	UTSW	18	19968354	missense	probably benign	0.00
R2143:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2144:Dsc3	UTSW	18	19980686	missense	possibly damaging	0.81
R2148:Dsc3	UTSW	18	19965638	missense	probably damaging	0.99
R3038:Dsc3	UTSW	18	19991560	missense	possibly damaging	0.58
R3872:Dsc3	UTSW	18	19971508	missense	probably damaging	0.99
R4229:Dsc3	UTSW	18	19965821	missense	probably damaging	1.00
R4298:Dsc3	UTSW	18	19980754	missense	possibly damaging	0.62
R4491:Dsc3	UTSW	18	20001865	missense	probably benign	0.30
R4590:Dsc3	UTSW	18	19989695	missense	probably damaging	1.00
R4615:Dsc3	UTSW	18	19971488	missense	possibly damaging	0.67
R5316:Dsc3	UTSW	18	19963541	missense	possibly damaging	0.67
R5758:Dsc3	UTSW	18	19989534	missense	probably damaging	1.00
R5796:Dsc3	UTSW	18	19971501	missense	probably benign	0.01
R5916:Dsc3	UTSW	18	19987020	missense	probably damaging	1.00
R6022:Dsc3	UTSW	18	19966338	missense	probably damaging	0.97
R6233:Dsc3	UTSW	18	19965795	missense	possibly damaging	0.77
R6351:Dsc3	UTSW	18	19966291	missense	probably benign	0.05
R6971:Dsc3	UTSW	18	19966218	critical splice donor site	probably null
R7261:Dsc3	UTSW	18	19980757	nonsense	probably null
R7442:Dsc3	UTSW	18	19981156	missense	probably damaging	1.00
R7795:Dsc3	UTSW	18	19966231	missense	probably damaging	1.00
R8051:Dsc3	UTSW	18	19981213	missense	probably damaging	1.00
R8531:Dsc3	UTSW	18	19968392	missense	probably benign
R8531:Dsc3	UTSW	18	19981217	missense	probably damaging	1.00
R8872:Dsc3	UTSW	18	19989622	missense	probably benign	0.02
R8927:Dsc3	UTSW	18	19974177	missense	probably benign
R8928:Dsc3	UTSW	18	19974177	missense	probably benign
R9140:Dsc3	UTSW	18	19989559	missense	probably benign	0.01
R9493:Dsc3	UTSW	18	19989695	nonsense	probably null
X0061:Dsc3	UTSW	18	19989627	missense	probably damaging	1.00
Z1177:Dsc3	UTSW	18	19966315	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTGTTTGCCAAGTTGAACTGAAAGGG -3'
(R):5'- CCGATAGTATCATCAGCAGGAGCCATC -3'

Sequencing Primer
(F):5'- TTGAACTGAAAGGGAGGGC -3'
(R):5'- gcaagaaatggatacaagtggg -3'

Posted On

2013-04-24