Incidental Mutation 'R0360:Dsc3'
ID 30070
Institutional Source Beutler Lab
Gene Symbol Dsc3
Ensembl Gene ENSMUSG00000059898
Gene Name desmocollin 3
MMRRC Submission 038566-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0360 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 19960930-20002351 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19971582 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 563 (T563S)
Ref Sequence ENSEMBL: ENSMUSP00000153261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115848] [ENSMUST00000225110]
AlphaFold P55850
Predicted Effect possibly damaging
Transcript: ENSMUST00000115848
AA Change: T563S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111514
Gene: ENSMUSG00000059898
AA Change: T563S

Cadherin_pro 31 113 9.08e-41 SMART
CA 156 241 4.99e-11 SMART
CA 265 353 7.79e-22 SMART
CA 376 471 2.66e-6 SMART
CA 494 576 4.58e-19 SMART
CA 595 677 3.02e-2 SMART
transmembrane domain 692 714 N/A INTRINSIC
Pfam:Cadherin_C 778 895 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000225110
AA Change: T563S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. Together with desmogleins, the encoded protein forms the transmembrane core of desmosomes, a multiprotein complex involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. Mice lacking the encoded protein exhibit a pre-implantation lethal phenotype. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice die before implantation. Heterozygous mice do not display any gross abnormalities and have normal epidermal development and keratinocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dpp6 T C 5: 27,652,269 L404P probably damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fancm A G 12: 65,075,950 Y82C probably damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hgd T A 16: 37,611,184 probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Il24 A G 1: 130,883,937 V134A probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Pcnx3 G A 19: 5,665,583 R1472W probably damaging Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Sparcl1 T A 5: 104,089,637 D444V probably damaging Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Vmn2r54 A T 7: 12,615,649 C669S probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Dsc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dsc3 APN 18 19985631 missense probably null 1.00
IGL01978:Dsc3 APN 18 19974196 missense possibly damaging 0.79
IGL02101:Dsc3 APN 18 20001906 missense probably benign 0.01
IGL02165:Dsc3 APN 18 19983652 missense probably benign 0.06
IGL02543:Dsc3 APN 18 19965828 missense probably benign 0.11
IGL02970:Dsc3 APN 18 19968260 missense probably damaging 1.00
IGL03097:Dsc3 UTSW 18 19974048 missense probably benign 0.30
R0133:Dsc3 UTSW 18 19971582 missense probably damaging 0.96
R0304:Dsc3 UTSW 18 19981241 missense probably damaging 1.00
R0673:Dsc3 UTSW 18 19989590 missense probably damaging 1.00
R0826:Dsc3 UTSW 18 19981172 missense probably damaging 0.99
R1120:Dsc3 UTSW 18 19986977 missense probably benign 0.05
R1491:Dsc3 UTSW 18 19987034 missense probably damaging 0.99
R1667:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R1688:Dsc3 UTSW 18 19966227 missense probably damaging 1.00
R1792:Dsc3 UTSW 18 19986998 missense probably damaging 1.00
R1858:Dsc3 UTSW 18 19965716 missense probably damaging 0.97
R1965:Dsc3 UTSW 18 19980672 missense probably damaging 1.00
R1988:Dsc3 UTSW 18 19965846 missense possibly damaging 0.86
R2049:Dsc3 UTSW 18 19989680 missense possibly damaging 0.65
R2127:Dsc3 UTSW 18 19968354 missense probably benign 0.00
R2143:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2144:Dsc3 UTSW 18 19980686 missense possibly damaging 0.81
R2148:Dsc3 UTSW 18 19965638 missense probably damaging 0.99
R3038:Dsc3 UTSW 18 19991560 missense possibly damaging 0.58
R3872:Dsc3 UTSW 18 19971508 missense probably damaging 0.99
R4229:Dsc3 UTSW 18 19965821 missense probably damaging 1.00
R4298:Dsc3 UTSW 18 19980754 missense possibly damaging 0.62
R4491:Dsc3 UTSW 18 20001865 missense probably benign 0.30
R4590:Dsc3 UTSW 18 19989695 missense probably damaging 1.00
R4615:Dsc3 UTSW 18 19971488 missense possibly damaging 0.67
R5316:Dsc3 UTSW 18 19963541 missense possibly damaging 0.67
R5758:Dsc3 UTSW 18 19989534 missense probably damaging 1.00
R5796:Dsc3 UTSW 18 19971501 missense probably benign 0.01
R5916:Dsc3 UTSW 18 19987020 missense probably damaging 1.00
R6022:Dsc3 UTSW 18 19966338 missense probably damaging 0.97
R6233:Dsc3 UTSW 18 19965795 missense possibly damaging 0.77
R6351:Dsc3 UTSW 18 19966291 missense probably benign 0.05
R6971:Dsc3 UTSW 18 19966218 critical splice donor site probably null
R7261:Dsc3 UTSW 18 19980757 nonsense probably null
R7442:Dsc3 UTSW 18 19981156 missense probably damaging 1.00
R7795:Dsc3 UTSW 18 19966231 missense probably damaging 1.00
R8051:Dsc3 UTSW 18 19981213 missense probably damaging 1.00
R8531:Dsc3 UTSW 18 19968392 missense probably benign
R8531:Dsc3 UTSW 18 19981217 missense probably damaging 1.00
R8872:Dsc3 UTSW 18 19989622 missense probably benign 0.02
R8927:Dsc3 UTSW 18 19974177 missense probably benign
R8928:Dsc3 UTSW 18 19974177 missense probably benign
R9140:Dsc3 UTSW 18 19989559 missense probably benign 0.01
X0061:Dsc3 UTSW 18 19989627 missense probably damaging 1.00
Z1177:Dsc3 UTSW 18 19966315 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcaagaaatggatacaagtggg -3'
Posted On 2013-04-24