Incidental Mutation 'R0360:Pcnx3'
ID30072
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
MMRRC Submission 038566-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0360 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5665583 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1472 (R1472W)
Ref Sequence ENSEMBL: ENSMUSP00000063786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000071857] [ENSMUST00000080824] [ENSMUST00000113615] [ENSMUST00000164304] [ENSMUST00000169854]
Predicted Effect probably damaging
Transcript: ENSMUST00000068169
AA Change: R1472W

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: R1472W

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071857
SMART Domains Protein: ENSMUSP00000073618
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 529 7.2e-64 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080824
SMART Domains Protein: ENSMUSP00000079637
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113615
AA Change: R1880W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: R1880W

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124905
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132420
Predicted Effect probably benign
Transcript: ENSMUST00000133136
SMART Domains Protein: ENSMUSP00000123666
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
Pfam:Pecanex_C 1 129 7.9e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146638
Predicted Effect probably benign
Transcript: ENSMUST00000164304
SMART Domains Protein: ENSMUSP00000128208
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169854
SMART Domains Protein: ENSMUSP00000132345
Gene: ENSMUSG00000056917

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
low complexity region 90 103 N/A INTRINSIC
low complexity region 164 192 N/A INTRINSIC
low complexity region 278 292 N/A INTRINSIC
Pfam:Rap_GAP 346 535 4.4e-60 PFAM
low complexity region 580 593 N/A INTRINSIC
PDZ 692 758 9.51e-7 SMART
low complexity region 828 841 N/A INTRINSIC
low complexity region 872 883 N/A INTRINSIC
coiled coil region 969 1023 N/A INTRINSIC
Meta Mutation Damage Score 0.1114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,611,128 probably benign Het
Adcyap1r1 G T 6: 55,475,523 probably benign Het
Ankrd6 T C 4: 32,836,424 T44A probably damaging Het
Ano7 A G 1: 93,388,658 D221G probably benign Het
Bhlhe40 C A 6: 108,664,750 N218K probably damaging Het
Bms1 A G 6: 118,405,290 V429A probably benign Het
C7 T A 15: 4,988,962 T800S probably benign Het
Camta2 G A 11: 70,683,310 T127I probably damaging Het
Ccdc13 T A 9: 121,798,216 N665I probably damaging Het
Ccdc157 T C 11: 4,146,663 E362G probably damaging Het
Ccdc73 T A 2: 104,981,007 N310K probably damaging Het
Cmklr1 A T 5: 113,614,517 L141H probably damaging Het
Cnst C A 1: 179,579,535 A49E probably benign Het
Col5a3 C T 9: 20,772,466 R1498Q unknown Het
Crybb3 T A 5: 113,075,953 I197F probably damaging Het
Cryzl1 G A 16: 91,707,267 P97S probably benign Het
Cubn T C 2: 13,310,507 probably benign Het
Cyp2d37-ps T C 15: 82,690,052 noncoding transcript Het
Cyp4a12b C A 4: 115,432,920 N223K probably benign Het
D16Ertd472e A T 16: 78,547,885 C112S probably benign Het
Dennd2a T C 6: 39,508,299 T349A probably benign Het
Dock5 G A 14: 67,822,680 probably benign Het
Dpp6 T C 5: 27,652,269 L404P probably damaging Het
Dsc3 T A 18: 19,971,582 T563S possibly damaging Het
Dync2h1 T A 9: 7,113,182 E214D possibly damaging Het
Elac2 A G 11: 64,979,310 Y67C probably damaging Het
Elmo1 A T 13: 20,564,493 K503* probably null Het
Eng T C 2: 32,679,137 S559P probably benign Het
Epc2 T A 2: 49,537,133 V563E possibly damaging Het
Fancm A G 12: 65,075,950 Y82C probably damaging Het
Flt4 A T 11: 49,636,991 M924L probably benign Het
Gabpa T A 16: 84,857,387 N317K possibly damaging Het
Gchfr T G 2: 119,167,846 Y3* probably null Het
Gli3 G T 13: 15,724,764 G912V probably benign Het
Gm10295 C A 7: 71,350,613 C73F unknown Het
Gm10382 G T 5: 125,389,664 probably benign Het
Gm6614 A C 6: 141,982,327 probably benign Het
Gp1ba T C 11: 70,640,458 probably benign Het
Gpr146 G A 5: 139,379,178 probably benign Het
Hexdc T A 11: 121,212,143 H62Q probably benign Het
Hgd T A 16: 37,611,184 probably benign Het
Hs6st1 G A 1: 36,069,185 probably null Het
Icam4 A G 9: 21,029,821 Y123C probably damaging Het
Il24 A G 1: 130,883,937 V134A probably damaging Het
Iqcb1 G T 16: 36,872,308 A562S probably damaging Het
Iqgap2 A C 13: 95,731,275 probably benign Het
Islr2 T C 9: 58,199,744 T78A possibly damaging Het
Kif1b A G 4: 149,262,729 I330T probably damaging Het
Kirrel T C 3: 87,089,799 Y287C probably damaging Het
Klf10 C T 15: 38,296,846 V317M probably benign Het
Klhl9 T G 4: 88,720,290 K571N probably benign Het
Lin37 T C 7: 30,557,013 I97V possibly damaging Het
Lrrc37a C T 11: 103,500,640 V1320I possibly damaging Het
Lrrc74a A G 12: 86,737,795 H99R probably damaging Het
Maats1 T A 16: 38,298,297 probably null Het
Me3 T A 7: 89,786,414 probably null Het
Med13 T C 11: 86,329,161 probably benign Het
Myh6 A T 14: 54,948,347 Y1490* probably null Het
Myo10 T C 15: 25,804,368 L1583P probably damaging Het
Nkx6-3 A G 8: 23,157,706 E227G possibly damaging Het
Nlrp1a T A 11: 71,114,004 probably benign Het
Nlrp5-ps A C 7: 14,583,091 noncoding transcript Het
Nup188 T G 2: 30,326,479 I765S probably null Het
Obscn G A 11: 59,128,281 A969V probably benign Het
Olfr1080 A T 2: 86,553,779 L115Q probably damaging Het
Olfr348 T A 2: 36,787,440 M305K probably benign Het
Olfr76 G T 19: 12,119,853 D286E possibly damaging Het
Olfr96 T C 17: 37,226,043 L306P possibly damaging Het
Otogl T A 10: 107,770,650 probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plscr4 T A 9: 92,488,761 probably benign Het
Pon2 G A 6: 5,266,156 Q288* probably null Het
Ptpn13 C A 5: 103,533,348 R805S probably damaging Het
Pyroxd2 A T 19: 42,747,553 V62D probably damaging Het
Rab37 G T 11: 115,156,964 C44F probably damaging Het
Rbm44 T C 1: 91,152,347 S52P probably benign Het
Rgl3 A G 9: 21,976,857 W454R probably damaging Het
Rita1 A G 5: 120,609,772 S154P probably benign Het
Scn5a T C 9: 119,522,599 D772G probably damaging Het
Sec23ip G A 7: 128,761,405 probably benign Het
Slc23a1 T A 18: 35,622,979 probably benign Het
Sparcl1 T A 5: 104,089,637 D444V probably damaging Het
Taar6 C A 10: 23,985,148 V167L probably benign Het
Tmcc3 T A 10: 94,578,545 N36K probably benign Het
Tmem200c T A 17: 68,840,548 V42E probably damaging Het
Trhde T C 10: 114,502,982 probably benign Het
Tshz3 A G 7: 36,770,533 E649G probably benign Het
Utp4 T C 8: 106,898,537 probably benign Het
Vmn1r30 A G 6: 58,435,277 V190A probably benign Het
Vmn1r35 A G 6: 66,678,843 I281T probably damaging Het
Vmn1r58 G T 7: 5,410,330 H300Q probably benign Het
Vmn1r84 A G 7: 12,361,872 L286P probably damaging Het
Vmn2r54 A T 7: 12,615,649 C669S probably damaging Het
Wdr61 A T 9: 54,727,578 probably benign Het
Zfp623 T C 15: 75,948,661 S489P probably benign Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
buns UTSW 19 5683340 start codon destroyed probably null
Pastries UTSW 19 5683339 nonsense probably null
Pecan UTSW 19 5672615 missense probably damaging 1.00
pie UTSW 19 5667158 missense possibly damaging 0.81
swirls UTSW 19 5672515 missense probably damaging 1.00
tip UTSW 19 5683780 splice site probably benign
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 splice site probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2358:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
R7177:Pcnx3 UTSW 19 5687499 missense probably benign 0.01
R7308:Pcnx3 UTSW 19 5686147 missense possibly damaging 0.52
R7387:Pcnx3 UTSW 19 5673336 missense probably benign 0.33
R7488:Pcnx3 UTSW 19 5667459 missense possibly damaging 0.72
R7670:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R7831:Pcnx3 UTSW 19 5685961 missense probably damaging 0.96
R7850:Pcnx3 UTSW 19 5678932 missense possibly damaging 0.55
R8120:Pcnx3 UTSW 19 5667546 missense probably benign
R8139:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R8258:Pcnx3 UTSW 19 5665384 missense probably damaging 1.00
R8259:Pcnx3 UTSW 19 5665384 missense probably damaging 1.00
R8260:Pcnx3 UTSW 19 5665384 missense probably damaging 1.00
R8261:Pcnx3 UTSW 19 5665384 missense probably damaging 1.00
R8262:Pcnx3 UTSW 19 5665384 missense probably damaging 1.00
R8350:Pcnx3 UTSW 19 5673226 missense probably damaging 1.00
R8411:Pcnx3 UTSW 19 5679590 missense possibly damaging 0.90
R8429:Pcnx3 UTSW 19 5665384 missense probably damaging 1.00
R8431:Pcnx3 UTSW 19 5665384 missense probably damaging 1.00
R8443:Pcnx3 UTSW 19 5686642 missense probably benign
R8450:Pcnx3 UTSW 19 5673226 missense probably damaging 1.00
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Z1176:Pcnx3 UTSW 19 5687220 critical splice acceptor site probably null
Z1177:Pcnx3 UTSW 19 5671626 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCCTCAGGAATACTGCTGTCCAAG -3'
(R):5'- TGGCACACCCTACGCCTGAAAATG -3'

Sequencing Primer
(F):5'- TACTGCTGTCCAAGCAAGG -3'
(R):5'- TACGCCTGAAAATGCAGCAG -3'
Posted On2013-04-24