Incidental Mutation 'R0361:Bcl2'
ID30075
Institutional Source Beutler Lab
Gene Symbol Bcl2
Ensembl Gene ENSMUSG00000057329
Gene NameB cell leukemia/lymphoma 2
SynonymsD830018M01Rik, C430015F12Rik, Bcl-2
MMRRC Submission 038567-MU
Accession Numbers

MGI: 88138

Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R0361 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106538178-106714274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106712694 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 63 (R63W)
Ref Sequence ENSEMBL: ENSMUSP00000139856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112751] [ENSMUST00000189999]
Predicted Effect probably damaging
Transcript: ENSMUST00000112751
AA Change: R63W

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108371
Gene: ENSMUSG00000057329
AA Change: R63W

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
transmembrane domain 211 233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189999
AA Change: R63W

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139856
Gene: ENSMUSG00000057329
AA Change: R63W

DomainStartEndE-ValueType
BH4 7 33 1.13e-12 SMART
BCL 94 192 4.43e-48 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: This gene encodes a member of the B cell lymphoma 2 protein family. Members of this family regulate cell death in multiple cell types and can have either proapoptotic or antiapoptotic activities. The protein encoded by this gene inhibits mitochondrial-mediated apoptosis. This protein is an integral outer mitochondrial membrane protein that functions as part of signaling pathway that controls mitochondrial permeability in response to apoptotic stimuli. This protein may also play a role in neuron cell survival and autophagy. Abnormal expression and chromosomal translocations of this gene are associated with cancer progression in numerous tissues. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show pleiotropic abnormalities including small size, increased postnatal mortality, polycystic kidneys, apoptotic involution of thymus and spleen, graying in the second hair follicle cycle, and reduced numbers of motor, sympathetic and sensory neurons. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(8) Gene trapped(2) Chemically induced(1)          

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,413,634 T303P possibly damaging Het
1700010I14Rik G T 17: 8,992,546 V176L probably benign Het
1700034J05Rik T C 6: 146,952,371 T262A possibly damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Apol10b A T 15: 77,585,386 M197K possibly damaging Het
Cacna1h A G 17: 25,389,422 M731T probably damaging Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cdk7 A T 13: 100,711,554 Y153* probably null Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Cfap65 A T 1: 74,925,440 L518Q probably damaging Het
Cngb3 A G 4: 19,366,467 H176R probably benign Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Dnajc13 A G 9: 104,167,059 M1867T probably benign Het
Dock2 A G 11: 34,438,327 L202P probably damaging Het
Dyrk3 A G 1: 131,130,032 S100P probably benign Het
Efr3b A T 12: 3,977,923 S376T probably benign Het
Eps8l2 A C 7: 141,356,199 N222T probably benign Het
Ermp1 A T 19: 29,631,406 Y158N probably damaging Het
Fam13a A G 6: 58,987,174 V91A probably benign Het
Fat3 A G 9: 15,998,403 V2101A possibly damaging Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Garem1 G T 18: 21,299,744 C9* probably null Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm5483 T C 16: 36,184,278 S7P probably damaging Het
H2-M5 A G 17: 36,987,436 I329T possibly damaging Het
Ing4 G A 6: 125,047,894 C200Y probably damaging Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Kdsr T C 1: 106,747,787 E102G probably damaging Het
Krt15 C T 11: 100,133,181 V346M probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Map2k6 T C 11: 110,499,509 F290L probably damaging Het
Mb21d1 T A 9: 78,433,252 K399N probably damaging Het
Me1 T A 9: 86,651,002 I136F probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mst1 T C 9: 108,084,897 F696L probably damaging Het
Mta1 A G 12: 113,133,341 probably null Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfm3 T A 3: 115,120,973 D211E probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Osmr A G 15: 6,841,951 probably null Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plch2 T C 4: 155,006,711 D148G possibly damaging Het
Plxnc1 C A 10: 94,865,007 C605F probably damaging Het
Ppm1m T C 9: 106,198,126 E108G probably damaging Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Ralgapa1 A G 12: 55,676,569 I1771T possibly damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Sec23a T G 12: 58,991,018 D324A probably damaging Het
Srgap1 A T 10: 122,047,192 M1K probably null Het
Syne2 T A 12: 75,918,610 F801I probably benign Het
Synrg T A 11: 84,024,337 probably null Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Vmn1r53 A T 6: 90,224,082 S87T possibly damaging Het
Vmn2r115 T A 17: 23,345,222 Y123N probably benign Het
Vmn2r28 T A 7: 5,493,716 I46F probably benign Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Bcl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Bcl2 APN 1 106712358 missense possibly damaging 0.95
IGL03076:Bcl2 APN 1 106543307 missense probably benign 0.24
Croce UTSW 1 106543281 missense probably damaging 1.00
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0002:Bcl2 UTSW 1 106712511 missense possibly damaging 0.94
R0083:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0086:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0107:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0183:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0217:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0219:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0346:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0347:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0348:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0470:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0471:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0601:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0609:Bcl2 UTSW 1 106712562 missense probably damaging 0.99
R0965:Bcl2 UTSW 1 106712291 missense probably benign 0.13
R1756:Bcl2 UTSW 1 106712392 missense probably damaging 1.00
R2764:Bcl2 UTSW 1 106712436 missense probably damaging 1.00
R4798:Bcl2 UTSW 1 106712608 missense possibly damaging 0.57
R4922:Bcl2 UTSW 1 106712646 missense probably benign 0.00
R6864:Bcl2 UTSW 1 106543281 missense probably damaging 1.00
R7576:Bcl2 UTSW 1 106712423 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACATCTCTGCGAAGTCACGACG -3'
(R):5'- TCTCATGCCAACGGGGAAACAC -3'

Sequencing Primer
(F):5'- CGAAGTCACGACGGTAGC -3'
(R):5'- CATTATAAGCTGTCACAGAGGGG -3'
Posted On2013-04-24