Incidental Mutation 'R0361:Kdsr'
ID30076
Institutional Source Beutler Lab
Gene Symbol Kdsr
Ensembl Gene ENSMUSG00000009905
Gene Name3-ketodihydrosphingosine reductase
SynonymsFvt1, 6330410P18Rik, 9430079B08Rik
MMRRC Submission 038567-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R0361 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location106720459-106759727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106747787 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 102 (E102G)
Ref Sequence ENSEMBL: ENSMUSP00000010049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010049]
Predicted Effect probably damaging
Transcript: ENSMUST00000010049
AA Change: E102G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905
AA Change: E102G

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:KR 33 214 9.4e-16 PFAM
Pfam:adh_short 33 232 1.1e-59 PFAM
Pfam:adh_short_C2 39 217 5.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187319
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,413,634 T303P possibly damaging Het
1700010I14Rik G T 17: 8,992,546 V176L probably benign Het
1700034J05Rik T C 6: 146,952,371 T262A possibly damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Apol10b A T 15: 77,585,386 M197K possibly damaging Het
Bcl2 G A 1: 106,712,694 R63W probably damaging Het
Cacna1h A G 17: 25,389,422 M731T probably damaging Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cdk7 A T 13: 100,711,554 Y153* probably null Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Cfap65 A T 1: 74,925,440 L518Q probably damaging Het
Cngb3 A G 4: 19,366,467 H176R probably benign Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Dnajc13 A G 9: 104,167,059 M1867T probably benign Het
Dock2 A G 11: 34,438,327 L202P probably damaging Het
Dyrk3 A G 1: 131,130,032 S100P probably benign Het
Efr3b A T 12: 3,977,923 S376T probably benign Het
Eps8l2 A C 7: 141,356,199 N222T probably benign Het
Ermp1 A T 19: 29,631,406 Y158N probably damaging Het
Fam13a A G 6: 58,987,174 V91A probably benign Het
Fat3 A G 9: 15,998,403 V2101A possibly damaging Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Garem1 G T 18: 21,299,744 C9* probably null Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm5483 T C 16: 36,184,278 S7P probably damaging Het
H2-M5 A G 17: 36,987,436 I329T possibly damaging Het
Ing4 G A 6: 125,047,894 C200Y probably damaging Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Krt15 C T 11: 100,133,181 V346M probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Map2k6 T C 11: 110,499,509 F290L probably damaging Het
Mb21d1 T A 9: 78,433,252 K399N probably damaging Het
Me1 T A 9: 86,651,002 I136F probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mst1 T C 9: 108,084,897 F696L probably damaging Het
Mta1 A G 12: 113,133,341 probably null Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfm3 T A 3: 115,120,973 D211E probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Osmr A G 15: 6,841,951 probably null Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plch2 T C 4: 155,006,711 D148G possibly damaging Het
Plxnc1 C A 10: 94,865,007 C605F probably damaging Het
Ppm1m T C 9: 106,198,126 E108G probably damaging Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Ralgapa1 A G 12: 55,676,569 I1771T possibly damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Sec23a T G 12: 58,991,018 D324A probably damaging Het
Srgap1 A T 10: 122,047,192 M1K probably null Het
Syne2 T A 12: 75,918,610 F801I probably benign Het
Synrg T A 11: 84,024,337 probably null Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Vmn1r53 A T 6: 90,224,082 S87T possibly damaging Het
Vmn2r115 T A 17: 23,345,222 Y123N probably benign Het
Vmn2r28 T A 7: 5,493,716 I46F probably benign Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Kdsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Kdsr APN 1 106755457 missense possibly damaging 0.91
IGL01375:Kdsr APN 1 106727694 missense probably benign 0.06
R1051:Kdsr UTSW 1 106747580 nonsense probably null
R1589:Kdsr UTSW 1 106734541 splice site probably null
R1679:Kdsr UTSW 1 106753226 missense probably benign 0.01
R4890:Kdsr UTSW 1 106753234 missense probably benign 0.21
R5392:Kdsr UTSW 1 106753241 missense possibly damaging 0.88
R5500:Kdsr UTSW 1 106759644 unclassified probably benign
R5830:Kdsr UTSW 1 106747532 missense possibly damaging 0.89
R5850:Kdsr UTSW 1 106755442 critical splice donor site probably null
R6005:Kdsr UTSW 1 106734581 missense probably benign 0.01
R7515:Kdsr UTSW 1 106734560 missense possibly damaging 0.89
R7841:Kdsr UTSW 1 106743685 missense probably damaging 1.00
R8282:Kdsr UTSW 1 106724997 missense probably benign 0.03
R8312:Kdsr UTSW 1 106747486 critical splice donor site probably null
R8392:Kdsr UTSW 1 106743853 missense probably damaging 1.00
R8507:Kdsr UTSW 1 106743670 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTAATGCCCATTTCCTCAGTG -3'
(R):5'- GGAGAGCTGTGAGCCCAAGTTATTC -3'

Sequencing Primer
(F):5'- ACTTTCCTGACATAGAGGTGC -3'
(R):5'- gtgtaggttaaaatagcccgaag -3'
Posted On2013-04-24