Incidental Mutation 'R0361:Cngb3'
ID30088
Institutional Source Beutler Lab
Gene Symbol Cngb3
Ensembl Gene ENSMUSG00000056494
Gene Namecyclic nucleotide gated channel beta 3
SynonymsCCNC2, CNG6, Cngbeta2
MMRRC Submission 038567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0361 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location19280850-19510623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19366467 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 176 (H176R)
Ref Sequence ENSEMBL: ENSMUSP00000100064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102999]
Predicted Effect probably benign
Transcript: ENSMUST00000102999
AA Change: H176R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100064
Gene: ENSMUSG00000056494
AA Change: H176R

DomainStartEndE-ValueType
Pfam:Ion_trans 210 445 5.7e-21 PFAM
cNMP 516 635 5.99e-23 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of a cyclic nucleotide-gated ion channel. The encoded beta subunit appears to play a role in modulation of channel function in cone photoreceptors. This heterotetrameric channel is necessary for sensory transduction, and mutations in this gene have been associated with achromatopsia 3, progressive cone dystrophy, and juvenile macular degeneration, also known as Stargardt Disease. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cone degeneration and decreased photopic response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,413,634 T303P possibly damaging Het
1700010I14Rik G T 17: 8,992,546 V176L probably benign Het
1700034J05Rik T C 6: 146,952,371 T262A possibly damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Apol10b A T 15: 77,585,386 M197K possibly damaging Het
Bcl2 G A 1: 106,712,694 R63W probably damaging Het
Cacna1h A G 17: 25,389,422 M731T probably damaging Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cdk7 A T 13: 100,711,554 Y153* probably null Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Cfap65 A T 1: 74,925,440 L518Q probably damaging Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Dnajc13 A G 9: 104,167,059 M1867T probably benign Het
Dock2 A G 11: 34,438,327 L202P probably damaging Het
Dyrk3 A G 1: 131,130,032 S100P probably benign Het
Efr3b A T 12: 3,977,923 S376T probably benign Het
Eps8l2 A C 7: 141,356,199 N222T probably benign Het
Ermp1 A T 19: 29,631,406 Y158N probably damaging Het
Fam13a A G 6: 58,987,174 V91A probably benign Het
Fat3 A G 9: 15,998,403 V2101A possibly damaging Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Garem1 G T 18: 21,299,744 C9* probably null Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm5483 T C 16: 36,184,278 S7P probably damaging Het
H2-M5 A G 17: 36,987,436 I329T possibly damaging Het
Ing4 G A 6: 125,047,894 C200Y probably damaging Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Kdsr T C 1: 106,747,787 E102G probably damaging Het
Krt15 C T 11: 100,133,181 V346M probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Map2k6 T C 11: 110,499,509 F290L probably damaging Het
Mb21d1 T A 9: 78,433,252 K399N probably damaging Het
Me1 T A 9: 86,651,002 I136F probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mst1 T C 9: 108,084,897 F696L probably damaging Het
Mta1 A G 12: 113,133,341 probably null Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfm3 T A 3: 115,120,973 D211E probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Osmr A G 15: 6,841,951 probably null Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plch2 T C 4: 155,006,711 D148G possibly damaging Het
Plxnc1 C A 10: 94,865,007 C605F probably damaging Het
Ppm1m T C 9: 106,198,126 E108G probably damaging Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Ralgapa1 A G 12: 55,676,569 I1771T possibly damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Sec23a T G 12: 58,991,018 D324A probably damaging Het
Srgap1 A T 10: 122,047,192 M1K probably null Het
Syne2 T A 12: 75,918,610 F801I probably benign Het
Synrg T A 11: 84,024,337 probably null Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Vmn1r53 A T 6: 90,224,082 S87T possibly damaging Het
Vmn2r115 T A 17: 23,345,222 Y123N probably benign Het
Vmn2r28 T A 7: 5,493,716 I46F probably benign Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Cngb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00740:Cngb3 APN 4 19280956 missense probably damaging 0.98
IGL01301:Cngb3 APN 4 19425625 missense probably damaging 1.00
IGL01735:Cngb3 APN 4 19415648 missense probably damaging 1.00
IGL01756:Cngb3 APN 4 19367850 missense probably damaging 1.00
IGL01812:Cngb3 APN 4 19461728 missense possibly damaging 0.86
IGL02123:Cngb3 APN 4 19367801 missense probably damaging 0.99
IGL02636:Cngb3 APN 4 19396690 missense probably damaging 1.00
IGL02648:Cngb3 APN 4 19428489 missense probably benign 0.00
IGL02935:Cngb3 APN 4 19425491 missense possibly damaging 0.95
IGL03025:Cngb3 APN 4 19283498 splice site probably benign
IGL03068:Cngb3 APN 4 19375246 missense possibly damaging 0.92
ANU18:Cngb3 UTSW 4 19425625 missense probably damaging 1.00
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0014:Cngb3 UTSW 4 19396685 missense probably benign 0.33
R0195:Cngb3 UTSW 4 19280975 missense probably benign 0.00
R0480:Cngb3 UTSW 4 19309517 splice site probably benign
R1103:Cngb3 UTSW 4 19309658 critical splice donor site probably null
R1450:Cngb3 UTSW 4 19395922 splice site probably benign
R1618:Cngb3 UTSW 4 19364260 missense probably benign
R1891:Cngb3 UTSW 4 19366446 missense probably benign 0.00
R2196:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R2850:Cngb3 UTSW 4 19415690 missense possibly damaging 0.64
R3909:Cngb3 UTSW 4 19461679 missense probably damaging 1.00
R3941:Cngb3 UTSW 4 19396786 missense probably benign 0.00
R4348:Cngb3 UTSW 4 19396688 missense probably damaging 1.00
R4490:Cngb3 UTSW 4 19415684 missense probably benign 0.41
R4493:Cngb3 UTSW 4 19367778 missense probably damaging 1.00
R4578:Cngb3 UTSW 4 19425613 missense probably damaging 1.00
R4719:Cngb3 UTSW 4 19309562 missense probably benign
R4774:Cngb3 UTSW 4 19415713 missense possibly damaging 0.85
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4860:Cngb3 UTSW 4 19425569 missense possibly damaging 0.50
R4898:Cngb3 UTSW 4 19395926 missense probably benign 0.08
R5216:Cngb3 UTSW 4 19415729 missense possibly damaging 0.93
R5647:Cngb3 UTSW 4 19364266 missense possibly damaging 0.51
R5945:Cngb3 UTSW 4 19283579 missense probably null 0.00
R6586:Cngb3 UTSW 4 19280946 missense probably damaging 0.99
R6650:Cngb3 UTSW 4 19364168 missense probably damaging 1.00
R6651:Cngb3 UTSW 4 19375231 missense probably benign 0.01
R7070:Cngb3 UTSW 4 19425593 missense possibly damaging 0.78
R7316:Cngb3 UTSW 4 19425599 missense probably benign 0.16
R7371:Cngb3 UTSW 4 19425575 missense possibly damaging 0.69
R7554:Cngb3 UTSW 4 19461753 nonsense probably null
X0062:Cngb3 UTSW 4 19364189 missense possibly damaging 0.91
X0067:Cngb3 UTSW 4 19367753 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCATGAGGATTTTGCTTTGGTTGTCTA -3'
(R):5'- TGGCTCTGAAAGAAGAGAGAACCAGT -3'

Sequencing Primer
(F):5'- CTTTGGTTGTCTACATGGAAAGAAG -3'
(R):5'- gtgtgtgtgtctgtgtgtg -3'
Posted On2013-04-24