Mutagenetix > Incidental Mutation

Incidental Mutation 'R0361:Plxnc1'

30118

Institutional Source

Beutler Lab

Gene Symbol

Plxnc1

Ensembl Gene

ENSMUSG00000074785

Gene Name

plexin C1

Synonyms

CD232, vespr, 2510048K12Rik

MMRRC Submission

038567-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.355) question?

Stock #

R0361 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94790866-94944835 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 94865007 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 605 (C605F)

Ref Sequence

ENSEMBL: ENSMUSP00000096939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099337]

AlphaFold

Q9QZC2

Predicted Effect

probably damaging
Transcript: ENSMUST00000099337
AA Change: C605F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: C605F

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
Pfam:Sema	87	431	5.5e-10	PFAM
PSI	454	507	5.28e-12	SMART
PSI	590	634	1.07e-3	SMART
Pfam:TIG	665	752	3.7e-9	PFAM
IPT	755	847	5.14e-7	SMART
IPT	849	954	1.8e-2	SMART
low complexity region	978	997	N/A	INTRINSIC
Pfam:Plexin_cytopl	1018	1541	1.4e-199	PFAM

Predicted Effect

silent
Transcript: ENSMUST00000181244

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.7%

Validation Efficiency

100% (1/1)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	T	G	3: 124,413,634	T303P	possibly damaging	Het
1700010I14Rik	G	T	17: 8,992,546	V176L	probably benign	Het
1700034J05Rik	T	C	6: 146,952,371	T262A	possibly damaging	Het
Adgrl3	A	T	5: 81,760,697	I1165F	probably damaging	Het
Ankhd1	T	C	18: 36,647,214	I1773T	probably damaging	Het
Api5	A	T	2: 94,423,497	L287*	probably null	Het
Apol10b	A	T	15: 77,585,386	M197K	possibly damaging	Het
Bcl2	G	A	1: 106,712,694	R63W	probably damaging	Het
Cacna1h	A	G	17: 25,389,422	M731T	probably damaging	Het
Cav1	C	A	6: 17,339,353	R146S	possibly damaging	Het
Cdhr2	A	T	13: 54,734,007	I1118F	probably damaging	Het
Cdk7	A	T	13: 100,711,554	Y153*	probably null	Het
Cemip	A	G	7: 83,964,010	I660T	probably benign	Het
Cfap65	A	T	1: 74,925,440	L518Q	probably damaging	Het
Cngb3	A	G	4: 19,366,467	H176R	probably benign	Het
Cux1	T	A	5: 136,279,497	I1263F	probably damaging	Het
Dnajc13	A	G	9: 104,167,059	M1867T	probably benign	Het
Dock2	A	G	11: 34,438,327	L202P	probably damaging	Het
Dyrk3	A	G	1: 131,130,032	S100P	probably benign	Het
Efr3b	A	T	12: 3,977,923	S376T	probably benign	Het
Eps8l2	A	C	7: 141,356,199	N222T	probably benign	Het
Ermp1	A	T	19: 29,631,406	Y158N	probably damaging	Het
Fam13a	A	G	6: 58,987,174	V91A	probably benign	Het
Fat3	A	G	9: 15,998,403	V2101A	possibly damaging	Het
Fsip2	T	C	2: 82,975,505	S723P	possibly damaging	Het
Garem1	G	T	18: 21,299,744	C9*	probably null	Het
Gdpd5	A	G	7: 99,458,790	I530V	possibly damaging	Het
Gm15217	T	A	14: 46,380,384		probably benign	Het
Gm4922	T	C	10: 18,783,541	T478A	probably benign	Het
Gm5483	T	C	16: 36,184,278	S7P	probably damaging	Het
H2-M5	A	G	17: 36,987,436	I329T	possibly damaging	Het
Ing4	G	A	6: 125,047,894	C200Y	probably damaging	Het
Kcnip1	A	T	11: 33,843,177	M5K	probably benign	Het
Kdsr	T	C	1: 106,747,787	E102G	probably damaging	Het
Krt15	C	T	11: 100,133,181	V346M	probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc55	A	T	2: 85,196,245	M145K	probably damaging	Het
Lrrtm2	A	G	18: 35,212,932	I439T	probably benign	Het
Map2k6	T	C	11: 110,499,509	F290L	probably damaging	Het
Mb21d1	T	A	9: 78,433,252	K399N	probably damaging	Het
Me1	T	A	9: 86,651,002	I136F	probably damaging	Het
Mfap2	A	G	4: 141,014,983	D98G	probably damaging	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mst1	T	C	9: 108,084,897	F696L	probably damaging	Het
Mta1	A	G	12: 113,133,341		probably null	Het
Myh15	A	T	16: 49,114,005	N645I	probably benign	Het
Myo7b	T	A	18: 32,014,209	I94F	probably damaging	Het
Nefh	A	T	11: 4,940,799	S607T	probably benign	Het
Noa1	G	A	5: 77,297,173	Q600*	probably null	Het
Nr2f2	A	G	7: 70,358,062	V71A	possibly damaging	Het
Oas2	A	T	5: 120,738,401	F492L	probably damaging	Het
Olfm3	T	A	3: 115,120,973	D211E	probably damaging	Het
Olfr1390	A	T	11: 49,340,814	Y94F	probably benign	Het
Osmr	A	G	15: 6,841,951		probably null	Het
Plagl2	A	T	2: 153,231,603	D459E	probably benign	Het
Plch2	T	C	4: 155,006,711	D148G	possibly damaging	Het
Ppm1m	T	C	9: 106,198,126	E108G	probably damaging	Het
Prr14l	A	C	5: 32,793,641	L1936R	probably damaging	Het
Ralgapa1	A	G	12: 55,676,569	I1771T	possibly damaging	Het
Rhobtb2	T	C	14: 69,795,908	T538A	probably benign	Het
Rictor	A	G	15: 6,784,107	N1025D	possibly damaging	Het
Sec23a	T	G	12: 58,991,018	D324A	probably damaging	Het
Srgap1	A	T	10: 122,047,192	M1K	probably null	Het
Syne2	T	A	12: 75,918,610	F801I	probably benign	Het
Synrg	T	A	11: 84,024,337		probably null	Het
Tas2r137	T	G	6: 40,491,298	F21V	probably benign	Het
Tmem260	A	T	14: 48,452,047	T108S	possibly damaging	Het
Trim2	T	C	3: 84,190,776	Y406C	probably damaging	Het
Ttn	T	C	2: 76,843,402		probably benign	Het
Vmn1r53	A	T	6: 90,224,082	S87T	possibly damaging	Het
Vmn2r115	T	A	17: 23,345,222	Y123N	probably benign	Het
Vmn2r28	T	A	7: 5,493,716	I46F	probably benign	Het
Zan	T	C	5: 137,396,766	T4381A	unknown	Het
Zfp457	A	G	13: 67,292,646	F622L	probably damaging	Het
Zfp994	A	T	17: 22,200,110	N619K	probably benign	Het
Zfy1	T	C	Y: 726,121	H548R	possibly damaging	Het
Zmym4	A	T	4: 126,911,145	S441T	probably benign	Het

Other mutations in Plxnc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00843:Plxnc1	APN	10	94847549	missense	probably benign	0.25
IGL01285:Plxnc1	APN	10	94799368	missense	probably damaging	0.99
IGL01867:Plxnc1	APN	10	94798146	missense	possibly damaging	0.61
IGL01994:Plxnc1	APN	10	94849939	missense	probably damaging	1.00
IGL02083:Plxnc1	APN	10	94922725	missense	possibly damaging	0.61
IGL02250:Plxnc1	APN	10	94871031	missense	probably benign	0.00
IGL02429:Plxnc1	APN	10	94882591	missense	probably benign	0.00
IGL02752:Plxnc1	APN	10	94794680	splice site	probably null
IGL02973:Plxnc1	APN	10	94810684	missense	probably damaging	1.00
R0230:Plxnc1	UTSW	10	94799347	missense	probably benign	0.07
R0265:Plxnc1	UTSW	10	94813129	missense	probably benign	0.14
R0271:Plxnc1	UTSW	10	94837918	missense	probably null	1.00
R0299:Plxnc1	UTSW	10	94849821	critical splice donor site	probably null
R0441:Plxnc1	UTSW	10	94796482	missense	probably damaging	1.00
R0558:Plxnc1	UTSW	10	94837935	missense	probably damaging	1.00
R0617:Plxnc1	UTSW	10	94799368	missense	probably damaging	1.00
R0671:Plxnc1	UTSW	10	94799332	missense	possibly damaging	0.63
R0692:Plxnc1	UTSW	10	94837500	critical splice donor site	probably null
R0751:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1184:Plxnc1	UTSW	10	94831333	splice site	probably benign
R1260:Plxnc1	UTSW	10	94831365	missense	probably damaging	0.99
R1680:Plxnc1	UTSW	10	94841551	missense	probably benign	0.14
R1746:Plxnc1	UTSW	10	94844179	splice site	probably null
R1750:Plxnc1	UTSW	10	94799497	missense	probably damaging	1.00
R1751:Plxnc1	UTSW	10	94849815	unclassified	probably benign
R1768:Plxnc1	UTSW	10	94844322	missense	probably benign	0.05
R1876:Plxnc1	UTSW	10	94866941	missense	possibly damaging	0.94
R2004:Plxnc1	UTSW	10	94852622	missense	probably damaging	0.98
R2031:Plxnc1	UTSW	10	94943667	missense	probably benign	0.26
R2184:Plxnc1	UTSW	10	94944269	missense	probably damaging	1.00
R2437:Plxnc1	UTSW	10	94906533	missense	probably benign	0.02
R2927:Plxnc1	UTSW	10	94793292	critical splice acceptor site	probably null
R3001:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3002:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3003:Plxnc1	UTSW	10	94793218	missense	probably damaging	0.98
R3441:Plxnc1	UTSW	10	94871010	missense	probably benign	0.00
R3849:Plxnc1	UTSW	10	94794432	missense	probably benign	0.01
R3884:Plxnc1	UTSW	10	94910687	splice site	probably null
R4004:Plxnc1	UTSW	10	94794597	nonsense	probably null
R4679:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
R4730:Plxnc1	UTSW	10	94867468	intron	probably benign
R4937:Plxnc1	UTSW	10	94841473	missense	probably damaging	1.00
R5068:Plxnc1	UTSW	10	94799377	missense	possibly damaging	0.91
R5345:Plxnc1	UTSW	10	94849969	missense	probably benign	0.26
R5397:Plxnc1	UTSW	10	94843752	missense	probably benign	0.08
R5416:Plxnc1	UTSW	10	94837554	missense	probably damaging	1.00
R5485:Plxnc1	UTSW	10	94922742	missense	probably benign	0.00
R5543:Plxnc1	UTSW	10	94864774	missense	probably benign
R5826:Plxnc1	UTSW	10	94799473	critical splice donor site	probably null
R6007:Plxnc1	UTSW	10	94793290	missense	possibly damaging	0.88
R6018:Plxnc1	UTSW	10	94943848	missense	probably benign	0.21
R6052:Plxnc1	UTSW	10	94943773	missense	probably benign	0.13
R6291:Plxnc1	UTSW	10	94833642	splice site	probably null
R6653:Plxnc1	UTSW	10	94943876	missense	probably damaging	1.00
R6984:Plxnc1	UTSW	10	94831530	missense	probably damaging	1.00
R7086:Plxnc1	UTSW	10	94831435	missense	probably benign
R7401:Plxnc1	UTSW	10	94871005	missense	probably benign
R7727:Plxnc1	UTSW	10	94944109	missense	probably damaging	1.00
R7789:Plxnc1	UTSW	10	94794477	missense	probably damaging	1.00
R7803:Plxnc1	UTSW	10	94943515	critical splice donor site	probably null
R7809:Plxnc1	UTSW	10	94794440	missense	probably damaging	1.00
R7882:Plxnc1	UTSW	10	94843836	missense	probably benign
R8103:Plxnc1	UTSW	10	94871082	missense	probably benign
R8226:Plxnc1	UTSW	10	94833368	missense	possibly damaging	0.90
R8273:Plxnc1	UTSW	10	94813243	missense	probably benign	0.14
R8299:Plxnc1	UTSW	10	94827179	missense	probably benign	0.35
R8392:Plxnc1	UTSW	10	94801490	missense	possibly damaging	0.75
R8758:Plxnc1	UTSW	10	94922745	missense	possibly damaging	0.91
R8806:Plxnc1	UTSW	10	94799278	missense	probably damaging	1.00
R8882:Plxnc1	UTSW	10	94841566	missense	probably damaging	1.00
R8893:Plxnc1	UTSW	10	94849847	missense	probably benign	0.35
R8956:Plxnc1	UTSW	10	94910586	missense	probably benign	0.00
R9040:Plxnc1	UTSW	10	94943517	nonsense	probably null
R9102:Plxnc1	UTSW	10	94827245	missense	probably damaging	1.00
R9225:Plxnc1	UTSW	10	94793199	missense	probably damaging	1.00
R9324:Plxnc1	UTSW	10	94944823	start gained	probably benign
R9368:Plxnc1	UTSW	10	94864737	nonsense	probably null
R9375:Plxnc1	UTSW	10	94813231	missense	probably benign	0.20
R9430:Plxnc1	UTSW	10	94922682	missense	probably benign	0.01
R9460:Plxnc1	UTSW	10	94865033	missense	probably benign
R9498:Plxnc1	UTSW	10	94813142	missense	possibly damaging	0.48
RF003:Plxnc1	UTSW	10	94794444	missense	probably damaging	1.00
RF045:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF046:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
RF047:Plxnc1	UTSW	10	94865007	missense	probably damaging	1.00
X0024:Plxnc1	UTSW	10	94864715	critical splice donor site	probably null
Z1176:Plxnc1	UTSW	10	94865029	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GCGACTTCTCCACAGCAACTTGAC -3'
(R):5'- ACACATAAAGCCTTGCTCGCTTCTC -3'

Sequencing Primer
(F):5'- GCTCCTGCATTGGAGAACATC -3'
(R):5'- AAAGGAAATCCTTCCTCCCTTTG -3'

Posted On

2013-04-24