Incidental Mutation 'R0361:Ermp1'
ID30153
Institutional Source Beutler Lab
Gene Symbol Ermp1
Ensembl Gene ENSMUSG00000046324
Gene Nameendoplasmic reticulum metallopeptidase 1
SynonymsD19Ertd410e, D19Wsu12e
MMRRC Submission 038567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0361 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29608214-29648415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29631406 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 158 (Y158N)
Ref Sequence ENSEMBL: ENSMUSP00000124992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054083] [ENSMUST00000159692] [ENSMUST00000162534]
Predicted Effect probably benign
Transcript: ENSMUST00000054083
SMART Domains Protein: ENSMUSP00000057069
Gene: ENSMUSG00000046324

DomainStartEndE-ValueType
SCOP:d1amp__ 31 159 3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159243
Predicted Effect probably damaging
Transcript: ENSMUST00000159692
AA Change: Y345N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124881
Gene: ENSMUSG00000046324
AA Change: Y345N

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 65 94 N/A INTRINSIC
Pfam:Peptidase_M28 179 373 1.3e-49 PFAM
Pfam:Peptidase_M20 184 375 2.9e-8 PFAM
transmembrane domain 405 427 N/A INTRINSIC
transmembrane domain 444 466 N/A INTRINSIC
transmembrane domain 481 503 N/A INTRINSIC
transmembrane domain 516 538 N/A INTRINSIC
transmembrane domain 543 562 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 617 639 N/A INTRINSIC
transmembrane domain 646 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161124
Predicted Effect probably damaging
Transcript: ENSMUST00000162534
AA Change: Y158N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124992
Gene: ENSMUSG00000046324
AA Change: Y158N

DomainStartEndE-ValueType
Pfam:Peptidase_M28 5 176 2.4e-40 PFAM
Pfam:Peptidase_M20 8 168 1.3e-8 PFAM
transmembrane domain 218 240 N/A INTRINSIC
transmembrane domain 257 279 N/A INTRINSIC
transmembrane domain 294 316 N/A INTRINSIC
transmembrane domain 329 351 N/A INTRINSIC
transmembrane domain 356 375 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.7%
Validation Efficiency 100% (1/1)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects including double outlet right ventricle, aortic arch anomalies and vascular ring, as well as anopthalmia, renal dysplasia, and craniofacial anomalies including short snout, cleft palate and cleft lip. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T G 3: 124,413,634 T303P possibly damaging Het
1700010I14Rik G T 17: 8,992,546 V176L probably benign Het
1700034J05Rik T C 6: 146,952,371 T262A possibly damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Apol10b A T 15: 77,585,386 M197K possibly damaging Het
Bcl2 G A 1: 106,712,694 R63W probably damaging Het
Cacna1h A G 17: 25,389,422 M731T probably damaging Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cdk7 A T 13: 100,711,554 Y153* probably null Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Cfap65 A T 1: 74,925,440 L518Q probably damaging Het
Cngb3 A G 4: 19,366,467 H176R probably benign Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Dnajc13 A G 9: 104,167,059 M1867T probably benign Het
Dock2 A G 11: 34,438,327 L202P probably damaging Het
Dyrk3 A G 1: 131,130,032 S100P probably benign Het
Efr3b A T 12: 3,977,923 S376T probably benign Het
Eps8l2 A C 7: 141,356,199 N222T probably benign Het
Fam13a A G 6: 58,987,174 V91A probably benign Het
Fat3 A G 9: 15,998,403 V2101A possibly damaging Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Garem1 G T 18: 21,299,744 C9* probably null Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm5483 T C 16: 36,184,278 S7P probably damaging Het
H2-M5 A G 17: 36,987,436 I329T possibly damaging Het
Ing4 G A 6: 125,047,894 C200Y probably damaging Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Kdsr T C 1: 106,747,787 E102G probably damaging Het
Krt15 C T 11: 100,133,181 V346M probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Map2k6 T C 11: 110,499,509 F290L probably damaging Het
Mb21d1 T A 9: 78,433,252 K399N probably damaging Het
Me1 T A 9: 86,651,002 I136F probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mst1 T C 9: 108,084,897 F696L probably damaging Het
Mta1 A G 12: 113,133,341 probably null Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfm3 T A 3: 115,120,973 D211E probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Osmr A G 15: 6,841,951 probably null Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plch2 T C 4: 155,006,711 D148G possibly damaging Het
Plxnc1 C A 10: 94,865,007 C605F probably damaging Het
Ppm1m T C 9: 106,198,126 E108G probably damaging Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Ralgapa1 A G 12: 55,676,569 I1771T possibly damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Sec23a T G 12: 58,991,018 D324A probably damaging Het
Srgap1 A T 10: 122,047,192 M1K probably null Het
Syne2 T A 12: 75,918,610 F801I probably benign Het
Synrg T A 11: 84,024,337 probably null Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Vmn1r53 A T 6: 90,224,082 S87T possibly damaging Het
Vmn2r115 T A 17: 23,345,222 Y123N probably benign Het
Vmn2r28 T A 7: 5,493,716 I46F probably benign Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfp994 A T 17: 22,200,110 N619K probably benign Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Ermp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Ermp1 APN 19 29639939 missense probably damaging 1.00
IGL01696:Ermp1 APN 19 29646138 missense possibly damaging 0.65
IGL01759:Ermp1 APN 19 29615836 missense probably benign 0.03
IGL01891:Ermp1 APN 19 29616602 missense probably benign 0.16
IGL02008:Ermp1 APN 19 29612920 missense probably damaging 1.00
IGL02034:Ermp1 APN 19 29645959 splice site probably benign
IGL02655:Ermp1 APN 19 29646210 nonsense probably null
IGL03074:Ermp1 APN 19 29612535 missense probably damaging 1.00
PIT4366001:Ermp1 UTSW 19 29628789 missense probably benign 0.24
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0050:Ermp1 UTSW 19 29628784 missense probably damaging 0.96
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0096:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R0684:Ermp1 UTSW 19 29632541 splice site probably benign
R0711:Ermp1 UTSW 19 29631388 missense possibly damaging 0.91
R1167:Ermp1 UTSW 19 29628679 missense possibly damaging 0.53
R1869:Ermp1 UTSW 19 29646015 missense possibly damaging 0.66
R1884:Ermp1 UTSW 19 29616679 missense probably benign 0.00
R2094:Ermp1 UTSW 19 29639928 missense probably benign 0.09
R2135:Ermp1 UTSW 19 29646065 missense possibly damaging 0.81
R2153:Ermp1 UTSW 19 29637398 critical splice acceptor site probably null
R2290:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R4176:Ermp1 UTSW 19 29645965 critical splice donor site probably null
R4363:Ermp1 UTSW 19 29612876 missense probably damaging 1.00
R4579:Ermp1 UTSW 19 29616651 missense probably damaging 0.98
R4761:Ermp1 UTSW 19 29646256 missense probably benign 0.03
R5801:Ermp1 UTSW 19 29612828 missense probably damaging 1.00
R5931:Ermp1 UTSW 19 29615729 missense probably benign 0.01
R6129:Ermp1 UTSW 19 29623209 missense possibly damaging 0.95
R6556:Ermp1 UTSW 19 29612921 missense possibly damaging 0.91
R6563:Ermp1 UTSW 19 29623778 missense probably damaging 1.00
R6598:Ermp1 UTSW 19 29632502 missense possibly damaging 0.82
R6647:Ermp1 UTSW 19 29626935 missense probably benign 0.27
R6850:Ermp1 UTSW 19 29616641 missense probably damaging 1.00
R6912:Ermp1 UTSW 19 29616611 missense probably benign 0.02
R7341:Ermp1 UTSW 19 29646254 missense probably benign 0.20
R7391:Ermp1 UTSW 19 29627068 critical splice acceptor site probably null
R7391:Ermp1 UTSW 19 29627069 critical splice acceptor site probably null
R7463:Ermp1 UTSW 19 29646262 nonsense probably null
R7471:Ermp1 UTSW 19 29612654 missense probably benign 0.06
R7831:Ermp1 UTSW 19 29617967 missense probably benign 0.00
R7836:Ermp1 UTSW 19 29632388 splice site probably null
R7923:Ermp1 UTSW 19 29628658 missense probably benign 0.01
R8113:Ermp1 UTSW 19 29615796 missense probably benign 0.00
R8116:Ermp1 UTSW 19 29623796 missense probably damaging 0.98
R8692:Ermp1 UTSW 19 29616693 missense probably benign 0.04
Z1088:Ermp1 UTSW 19 29612925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAAGTCTGTAACGCATTTGGC -3'
(R):5'- CTCACCAAAGCAGCGTTCTTGATG -3'

Sequencing Primer
(F):5'- GGCCACATACTGTCTCTCTC -3'
(R):5'- GGTTCGTAACTGCCCAAATTC -3'
Posted On2013-04-24