Incidental Mutation 'R0363:Ubr4'
ID30175
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Nameubiquitin protein ligase E3 component n-recognin 4
SynonymsLOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik
MMRRC Submission 038569-MU
Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0363 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139352609-139489588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139391860 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 152 (T152A)
Ref Sequence ENSEMBL: ENSMUSP00000125800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]
Predicted Effect probably damaging
Transcript: ENSMUST00000097822
AA Change: T152A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: T152A

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133220
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165860
AA Change: T152A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: T152A

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.5%
Validation Efficiency 98% (78/80)
MGI Phenotype Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik T A 4: 109,524,323 Q86L probably null Het
5430403G16Rik T C 5: 109,676,888 E232G probably benign Het
Abhd2 A G 7: 79,350,813 D262G possibly damaging Het
Abhd5 T C 9: 122,368,146 F133L possibly damaging Het
Agap2 T A 10: 127,090,965 V957E probably damaging Het
Ankrd12 T C 17: 65,985,681 K919R probably damaging Het
Ap1m1 T C 8: 72,256,724 probably benign Het
Ap1m1 T C 8: 72,252,894 S245P probably benign Het
Apcdd1 A G 18: 62,937,097 Y145C possibly damaging Het
Apob A T 12: 8,010,136 N2840Y probably damaging Het
Arel1 A G 12: 84,934,253 S327P probably damaging Het
Arhgap21 C A 2: 20,881,133 R421L probably damaging Het
Ccdc85a A T 11: 28,583,400 I48N probably damaging Het
Chd6 A G 2: 161,014,324 S672P probably damaging Het
Ciz1 G C 2: 32,377,363 probably null Het
Cmbl G A 15: 31,585,442 probably null Het
Cmya5 A G 13: 93,094,869 V1237A possibly damaging Het
Cntnap4 A T 8: 112,856,511 K1074* probably null Het
Cntnap5b A G 1: 100,274,468 M347V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cuzd1 A T 7: 131,316,262 M203K probably benign Het
Cyp3a16 T C 5: 145,455,879 probably benign Het
Dlgap3 A G 4: 127,235,521 E892G probably damaging Het
Dnah7b T C 1: 46,236,788 S2612P probably damaging Het
Epas1 T G 17: 86,805,848 probably benign Het
Etv5 G A 16: 22,411,708 A192V probably benign Het
Fa2h T A 8: 111,349,289 H234L probably damaging Het
Fcho1 T C 8: 71,717,490 Y47C probably damaging Het
Flvcr1 T A 1: 191,012,254 probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b T C 8: 81,884,257 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kmt2a A G 9: 44,809,713 probably null Het
Krt4 G A 15: 101,924,646 R9C possibly damaging Het
Map1a T C 2: 121,302,044 S876P probably damaging Het
Mettl21e A G 1: 44,211,030 probably null Het
Msh2 C T 17: 87,717,476 T594M probably benign Het
Mtmr3 A G 11: 4,487,536 S973P probably damaging Het
Muc5ac A T 7: 141,800,960 M889L probably benign Het
Ntn1 A G 11: 68,385,543 I193T probably benign Het
Nudt13 A T 14: 20,309,783 I193F probably damaging Het
Olfr1272 A T 2: 90,281,856 S240T probably damaging Het
Olfr134 A G 17: 38,175,447 D121G probably damaging Het
Olfr410 C T 11: 74,335,099 G44D probably damaging Het
Olfr498 A T 7: 108,465,734 T137S possibly damaging Het
Otulin A G 15: 27,606,295 V344A probably damaging Het
P2rx7 C T 5: 122,657,030 Q128* probably null Het
Pcdhb22 G A 18: 37,519,160 R227H probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pltp C T 2: 164,840,136 R394H probably benign Het
Ppip5k1 C G 2: 121,347,355 A324P probably damaging Het
Pramef17 C T 4: 143,991,651 M407I probably benign Het
Prdm13 A C 4: 21,679,737 V251G unknown Het
Prkg1 T C 19: 31,664,196 E29G probably damaging Het
Prrc2c A G 1: 162,697,811 S409P unknown Het
Rp1 T A 1: 4,347,718 D1057V probably damaging Het
Rttn G A 18: 89,010,955 C599Y probably damaging Het
Shisa6 C T 11: 66,525,327 R213Q probably benign Het
Slc3a1 T C 17: 85,032,845 Y232H probably damaging Het
Slx4 G A 16: 3,980,089 A1477V probably damaging Het
Ssrp1 T G 2: 85,040,674 I218S probably damaging Het
St6galnac1 A C 11: 116,768,930 S186A probably benign Het
Stab1 A G 14: 31,159,008 probably benign Het
Sycp2 T C 2: 178,346,411 probably benign Het
Syne2 T A 12: 76,072,207 I5867N probably damaging Het
Taar7f T A 10: 24,049,941 D144E probably damaging Het
Tmem136 A T 9: 43,111,753 M84K probably damaging Het
Tmem87b T A 2: 128,831,233 S196T probably damaging Het
Tnfrsf21 A G 17: 43,037,877 T127A probably benign Het
Trp73 A G 4: 154,063,949 I336T probably benign Het
Ttl A G 2: 129,076,061 I148V probably damaging Het
Ttll7 T C 3: 146,944,215 Y667H probably benign Het
Vmn1r58 A T 7: 5,410,637 V198E probably damaging Het
Vps52 T A 17: 33,962,117 F376L probably benign Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139465322 missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139428566 missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139455184 missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139421245 missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139440766 missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139476282 missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL01126:Ubr4 APN 4 139402555 missense probably benign 0.04
IGL01311:Ubr4 APN 4 139479045 missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139480728 missense unknown
IGL01388:Ubr4 APN 4 139460243 missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139410800 missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139438040 splice site probably benign
IGL01449:Ubr4 APN 4 139412736 missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139442829 splice site probably benign
IGL01568:Ubr4 APN 4 139421373 missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139462534 splice site probably benign
IGL01621:Ubr4 APN 4 139440783 nonsense probably null
IGL01639:Ubr4 APN 4 139417344 missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139407796 missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139418461 missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139472500 missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139477158 missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139412678 nonsense probably null
IGL01874:Ubr4 APN 4 139393289 splice site probably benign
IGL01889:Ubr4 APN 4 139462472 nonsense probably null
IGL01891:Ubr4 APN 4 139436260 critical splice donor site probably null
IGL01980:Ubr4 APN 4 139429602 missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139452741 critical splice donor site probably null
IGL02153:Ubr4 APN 4 139460160 nonsense probably null
IGL02173:Ubr4 APN 4 139437070 splice site probably null
IGL02214:Ubr4 APN 4 139428583 missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139461827 critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139388435 missense probably benign 0.01
IGL02246:Ubr4 APN 4 139459103 missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139455628 nonsense probably null
IGL02273:Ubr4 APN 4 139472578 missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139473178 missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139478922 missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139421249 nonsense probably null
IGL02477:Ubr4 APN 4 139436205 missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139415118 missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139467250 nonsense probably null
IGL02679:Ubr4 APN 4 139459134 missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139468811 missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139410784 missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL02892:Ubr4 APN 4 139417331 missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139472508 missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139425295 missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139407820 missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139480676 missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139409730 missense probably benign 0.02
IGL03087:Ubr4 APN 4 139450357 nonsense probably null
IGL03116:Ubr4 APN 4 139479581 splice site probably benign
IGL03212:Ubr4 APN 4 139409763 missense probably benign 0.13
IGL03228:Ubr4 APN 4 139429598 missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139440435 missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139415032 missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139452678 missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139399929 nonsense probably null
Aqua_regia UTSW 4 139452719 nonsense probably null
P0019:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
PIT4544001:Ubr4 UTSW 4 139402560 missense possibly damaging 0.93
R0001:Ubr4 UTSW 4 139451788 missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139390900 missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0008:Ubr4 UTSW 4 139430176 missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139426793 missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0088:Ubr4 UTSW 4 139440814 missense probably damaging 1.00
R0131:Ubr4 UTSW 4 139464051 missense possibly damaging 0.66
R0184:Ubr4 UTSW 4 139445262 missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139430257 missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0270:Ubr4 UTSW 4 139479435 splice site probably benign
R0285:Ubr4 UTSW 4 139440801 missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139422418 missense probably damaging 1.00
R0393:Ubr4 UTSW 4 139410860 splice site probably benign
R0450:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0504:Ubr4 UTSW 4 139406578 missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139480838 critical splice donor site probably null
R0510:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0513:Ubr4 UTSW 4 139416875 missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139392124 missense probably benign 0.00
R0558:Ubr4 UTSW 4 139426902 missense probably benign 0.09
R0617:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R0636:Ubr4 UTSW 4 139436302 intron probably null
R0637:Ubr4 UTSW 4 139399615 missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139401326 missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139423906 missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139485320 missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139428028 splice site probably null
R0751:Ubr4 UTSW 4 139437198 splice site probably benign
R0789:Ubr4 UTSW 4 139410271 critical splice donor site probably null
R0825:Ubr4 UTSW 4 139479576 critical splice donor site probably null
R0828:Ubr4 UTSW 4 139450553 splice site probably benign
R1052:Ubr4 UTSW 4 139455460 missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139437198 splice site probably benign
R1222:Ubr4 UTSW 4 139388471 splice site probably null
R1258:Ubr4 UTSW 4 139426914 missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139460123 missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139402612 missense probably benign 0.00
R1450:Ubr4 UTSW 4 139468028 missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1474:Ubr4 UTSW 4 139429579 missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139425840 missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139428151 missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139416927 nonsense probably null
R1785:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139393053 missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139428596 missense probably benign 0.25
R1800:Ubr4 UTSW 4 139407963 missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139452563 splice site probably null
R1827:Ubr4 UTSW 4 139425697 critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139455560 missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139451244 critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139480652 missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139479540 missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139429611 nonsense probably null
R2140:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R2237:Ubr4 UTSW 4 139442790 missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139448921 missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139413462 missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139420373 splice site probably benign
R2353:Ubr4 UTSW 4 139433673 missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139473542 missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139473205 unclassified probably benign
R2896:Ubr4 UTSW 4 139455644 splice site probably null
R2922:Ubr4 UTSW 4 139479500 missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2973:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2989:Ubr4 UTSW 4 139463558 missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3276:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3772:Ubr4 UTSW 4 139452700 missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139459126 missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139423990 missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R3951:Ubr4 UTSW 4 139393094 missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139451805 missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139393414 missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139472509 missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139410440 missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139418502 missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139380853 missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139399579 missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139406518 missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139436191 missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139408672 missense probably benign 0.09
R4701:Ubr4 UTSW 4 139471336 missense possibly damaging 0.66
R4705:Ubr4 UTSW 4 139450529 missense probably damaging 1.00
R4726:Ubr4 UTSW 4 139482579 missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139423879 missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139421733 missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139402546 missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139428517 missense probably benign 0.14
R4936:Ubr4 UTSW 4 139396566 missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139436169 missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139410623 missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R5197:Ubr4 UTSW 4 139468097 missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139402566 nonsense probably null
R5219:Ubr4 UTSW 4 139477232 nonsense probably null
R5346:Ubr4 UTSW 4 139428491 missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139397528 intron probably benign
R5442:Ubr4 UTSW 4 139407772 missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139480788 missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139460090 missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139392038 missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139452648 missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139444687 missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139428583 missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139460095 missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139468096 missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139425218 missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139468847 missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139425330 missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139408626 nonsense probably null
R5901:Ubr4 UTSW 4 139451254 missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139455638 missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139421078 splice site probably null
R6065:Ubr4 UTSW 4 139421238 missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139417364 missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139421248 missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139452640 missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139408889 missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139429539 missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139429638 missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139397214 critical splice donor site probably null
R6481:Ubr4 UTSW 4 139431751 missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139444671 missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139414394 missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139455586 missense probably benign 0.17
R6648:Ubr4 UTSW 4 139452719 nonsense probably null
R6649:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139465341 missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139489182 missense unknown
R6772:Ubr4 UTSW 4 139467230 nonsense probably null
R6857:Ubr4 UTSW 4 139486051 missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139467227 missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139458234 critical splice donor site probably null
R6943:Ubr4 UTSW 4 139437131 nonsense probably null
R6970:Ubr4 UTSW 4 139406528 nonsense probably null
R6976:Ubr4 UTSW 4 139393077 missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139414404 missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139393090 missense probably damaging 0.99
R7165:Ubr4 UTSW 4 139450513 missense
R7222:Ubr4 UTSW 4 139463373 missense unknown
R7241:Ubr4 UTSW 4 139443414 missense probably damaging 1.00
R7343:Ubr4 UTSW 4 139413438 missense probably benign 0.09
R7367:Ubr4 UTSW 4 139452691 missense unknown
R7393:Ubr4 UTSW 4 139426785 missense probably damaging 1.00
R7432:Ubr4 UTSW 4 139388382 missense probably damaging 1.00
R7448:Ubr4 UTSW 4 139462467 missense unknown
R7502:Ubr4 UTSW 4 139412672 missense possibly damaging 0.72
R7514:Ubr4 UTSW 4 139452655 missense unknown
R7526:Ubr4 UTSW 4 139422417 missense probably benign 0.00
R7529:Ubr4 UTSW 4 139422417 missense probably benign 0.00
R7666:Ubr4 UTSW 4 139413480 missense possibly damaging 0.81
R7699:Ubr4 UTSW 4 139408867 nonsense probably null
R7700:Ubr4 UTSW 4 139408867 nonsense probably null
R7726:Ubr4 UTSW 4 139458920 missense unknown
T0975:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139410271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGTAGGAACCCAAGTCTGACCCC -3'
(R):5'- TGCCCCTGACCAAAATGGTATGATG -3'

Sequencing Primer
(F):5'- GAACCCAAGTCTGACCCCATTAC -3'
(R):5'- GGTTCAAAAAGTTCATCTGTACCTCC -3'
Posted On2013-04-24