Incidental Mutation 'R0363:Muc5ac'
ID 30184
Institutional Source Beutler Lab
Gene Symbol Muc5ac
Ensembl Gene ENSMUSG00000037974
Gene Name mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms MGM, 2210005L13Rik
MMRRC Submission 038569-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0363 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141788972-141819231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141800960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 889 (M889L)
Ref Sequence ENSEMBL: ENSMUSP00000131681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041924] [ENSMUST00000155534] [ENSMUST00000163321]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041924
AA Change: M889L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000039699
Gene: ENSMUSG00000037974
AA Change: M889L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 1.6e-14 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 6.1e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1482 2.3e-25 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1692 2.2e-27 PFAM
Pfam:Mucin2_WxxW 1765 1857 8.6e-27 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155534
AA Change: M890L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000122353
Gene: ENSMUSG00000037974
AA Change: M890L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 9.6e-15 PFAM
VWC 395 437 3.54e-1 SMART
VWD 422 586 2.35e-33 SMART
C8 623 697 8.42e-36 SMART
Pfam:TIL 703 760 3.6e-9 PFAM
VWC 762 826 6.75e-1 SMART
VWC 864 906 4.06e-1 SMART
VWD 891 1051 1.51e-45 SMART
C8 1087 1161 2.78e-36 SMART
low complexity region 1316 1331 N/A INTRINSIC
low complexity region 1334 1367 N/A INTRINSIC
low complexity region 1372 1388 N/A INTRINSIC
Pfam:Mucin2_WxxW 1395 1483 1.3e-25 PFAM
low complexity region 1522 1533 N/A INTRINSIC
low complexity region 1537 1564 N/A INTRINSIC
low complexity region 1579 1596 N/A INTRINSIC
Pfam:Mucin2_WxxW 1605 1693 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163321
AA Change: M889L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000131681
Gene: ENSMUSG00000037974
AA Change: M889L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWD 69 226 4.19e-30 SMART
C8 258 334 1.34e-11 SMART
Pfam:TIL 337 393 7.9e-15 PFAM
VWC 395 462 8.6e-18 SMART
VWD 421 585 1.55e-33 SMART
C8 622 696 8.42e-36 SMART
Pfam:TIL 702 759 1.9e-9 PFAM
VWC 761 825 6.75e-1 SMART
VWC 863 905 4.06e-1 SMART
VWD 890 1050 1.51e-45 SMART
C8 1086 1160 2.78e-36 SMART
low complexity region 1315 1330 N/A INTRINSIC
low complexity region 1333 1366 N/A INTRINSIC
low complexity region 1371 1387 N/A INTRINSIC
Pfam:Mucin2_WxxW 1394 1481 1.1e-23 PFAM
low complexity region 1521 1532 N/A INTRINSIC
low complexity region 1536 1563 N/A INTRINSIC
low complexity region 1578 1595 N/A INTRINSIC
Pfam:Mucin2_WxxW 1604 1691 1.1e-25 PFAM
Pfam:Mucin2_WxxW 1765 1856 6.3e-24 PFAM
low complexity region 1875 1895 N/A INTRINSIC
low complexity region 1949 1968 N/A INTRINSIC
VWD 2030 2199 4.17e-48 SMART
C8 2242 2311 3.95e-9 SMART
VWC 2376 2439 1.04e-11 SMART
VWC 2479 2543 9.31e-5 SMART
CT 2625 2711 3.43e-32 SMART
low complexity region 2720 2733 N/A INTRINSIC
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.5%
Validation Efficiency 98% (78/80)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to T. muris infection with persistent worm burden, goblet cell hyperplasia, and increased serum IFN-gamma despite a normal TH2-type immune response. A portion of mice show corneal opacity and poor tear quality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik T A 4: 109,524,323 Q86L probably null Het
5430403G16Rik T C 5: 109,676,888 E232G probably benign Het
Abhd2 A G 7: 79,350,813 D262G possibly damaging Het
Abhd5 T C 9: 122,368,146 F133L possibly damaging Het
Agap2 T A 10: 127,090,965 V957E probably damaging Het
Ankrd12 T C 17: 65,985,681 K919R probably damaging Het
Ap1m1 T C 8: 72,252,894 S245P probably benign Het
Ap1m1 T C 8: 72,256,724 probably benign Het
Apcdd1 A G 18: 62,937,097 Y145C possibly damaging Het
Apob A T 12: 8,010,136 N2840Y probably damaging Het
Arel1 A G 12: 84,934,253 S327P probably damaging Het
Arhgap21 C A 2: 20,881,133 R421L probably damaging Het
Ccdc85a A T 11: 28,583,400 I48N probably damaging Het
Chd6 A G 2: 161,014,324 S672P probably damaging Het
Ciz1 G C 2: 32,377,363 probably null Het
Cmbl G A 15: 31,585,442 probably null Het
Cmya5 A G 13: 93,094,869 V1237A possibly damaging Het
Cntnap4 A T 8: 112,856,511 K1074* probably null Het
Cntnap5b A G 1: 100,274,468 M347V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cuzd1 A T 7: 131,316,262 M203K probably benign Het
Cyp3a16 T C 5: 145,455,879 probably benign Het
Dlgap3 A G 4: 127,235,521 E892G probably damaging Het
Dnah7b T C 1: 46,236,788 S2612P probably damaging Het
Epas1 T G 17: 86,805,848 probably benign Het
Etv5 G A 16: 22,411,708 A192V probably benign Het
Fa2h T A 8: 111,349,289 H234L probably damaging Het
Fcho1 T C 8: 71,717,490 Y47C probably damaging Het
Flvcr1 T A 1: 191,012,254 probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b T C 8: 81,884,257 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kmt2a A G 9: 44,809,713 probably null Het
Krt4 G A 15: 101,924,646 R9C possibly damaging Het
Map1a T C 2: 121,302,044 S876P probably damaging Het
Mettl21e A G 1: 44,211,030 probably null Het
Msh2 C T 17: 87,717,476 T594M probably benign Het
Mtmr3 A G 11: 4,487,536 S973P probably damaging Het
Ntn1 A G 11: 68,385,543 I193T probably benign Het
Nudt13 A T 14: 20,309,783 I193F probably damaging Het
Olfr1272 A T 2: 90,281,856 S240T probably damaging Het
Olfr134 A G 17: 38,175,447 D121G probably damaging Het
Olfr410 C T 11: 74,335,099 G44D probably damaging Het
Olfr498 A T 7: 108,465,734 T137S possibly damaging Het
Otulin A G 15: 27,606,295 V344A probably damaging Het
P2rx7 C T 5: 122,657,030 Q128* probably null Het
Pcdhb22 G A 18: 37,519,160 R227H probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pltp C T 2: 164,840,136 R394H probably benign Het
Ppip5k1 C G 2: 121,347,355 A324P probably damaging Het
Pramef17 C T 4: 143,991,651 M407I probably benign Het
Prdm13 A C 4: 21,679,737 V251G unknown Het
Prkg1 T C 19: 31,664,196 E29G probably damaging Het
Prrc2c A G 1: 162,697,811 S409P unknown Het
Rp1 T A 1: 4,347,718 D1057V probably damaging Het
Rttn G A 18: 89,010,955 C599Y probably damaging Het
Shisa6 C T 11: 66,525,327 R213Q probably benign Het
Slc3a1 T C 17: 85,032,845 Y232H probably damaging Het
Slx4 G A 16: 3,980,089 A1477V probably damaging Het
Ssrp1 T G 2: 85,040,674 I218S probably damaging Het
St6galnac1 A C 11: 116,768,930 S186A probably benign Het
Stab1 A G 14: 31,159,008 probably benign Het
Sycp2 T C 2: 178,346,411 probably benign Het
Syne2 T A 12: 76,072,207 I5867N probably damaging Het
Taar7f T A 10: 24,049,941 D144E probably damaging Het
Tmem136 A T 9: 43,111,753 M84K probably damaging Het
Tmem87b T A 2: 128,831,233 S196T probably damaging Het
Tnfrsf21 A G 17: 43,037,877 T127A probably benign Het
Trp73 A G 4: 154,063,949 I336T probably benign Het
Ttl A G 2: 129,076,061 I148V probably damaging Het
Ttll7 T C 3: 146,944,215 Y667H probably benign Het
Ubr4 A G 4: 139,391,860 T152A probably damaging Het
Vmn1r58 A T 7: 5,410,637 V198E probably damaging Het
Vps52 T A 17: 33,962,117 F376L probably benign Het
Other mutations in Muc5ac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Muc5ac APN 7 141812703 missense possibly damaging 0.93
IGL01064:Muc5ac APN 7 141807473 missense probably benign 0.12
IGL01155:Muc5ac APN 7 141806943 splice site probably benign
IGL01452:Muc5ac APN 7 141817555 missense probably benign 0.00
IGL01590:Muc5ac APN 7 141798893 missense probably benign 0.02
IGL02104:Muc5ac APN 7 141811078 missense probably damaging 0.98
IGL02152:Muc5ac APN 7 141800177 missense possibly damaging 0.86
IGL02153:Muc5ac APN 7 141818800 nonsense probably null
IGL02178:Muc5ac APN 7 141805447 splice site probably benign
IGL02403:Muc5ac APN 7 141803450 missense possibly damaging 0.71
IGL02576:Muc5ac APN 7 141817044 missense probably benign 0.01
IGL02665:Muc5ac APN 7 141791086 missense possibly damaging 0.71
IGL02704:Muc5ac APN 7 141795263 missense possibly damaging 0.71
IGL02808:Muc5ac APN 7 141805775 missense possibly damaging 0.72
IGL03283:Muc5ac APN 7 141813781 missense probably benign 0.34
IGL03384:Muc5ac APN 7 141812403 missense possibly damaging 0.71
IGL03046:Muc5ac UTSW 7 141795213 missense probably benign 0.27
PIT4515001:Muc5ac UTSW 7 141807416 missense probably damaging 0.99
R0092:Muc5ac UTSW 7 141818630 missense possibly damaging 0.72
R0145:Muc5ac UTSW 7 141795275 missense possibly damaging 0.71
R0147:Muc5ac UTSW 7 141811039 missense probably benign 0.08
R0384:Muc5ac UTSW 7 141812251 missense possibly damaging 0.71
R0440:Muc5ac UTSW 7 141792034 nonsense probably null
R0583:Muc5ac UTSW 7 141807608 missense probably damaging 0.99
R0616:Muc5ac UTSW 7 141796244 missense probably benign 0.02
R0682:Muc5ac UTSW 7 141805669 missense possibly damaging 0.53
R0685:Muc5ac UTSW 7 141807709 missense probably benign 0.03
R0883:Muc5ac UTSW 7 141796265 missense possibly damaging 0.71
R0924:Muc5ac UTSW 7 141807515 missense possibly damaging 0.68
R1300:Muc5ac UTSW 7 141816929 missense possibly damaging 0.73
R1315:Muc5ac UTSW 7 141807323 missense probably damaging 0.99
R1354:Muc5ac UTSW 7 141807377 missense probably damaging 0.99
R1484:Muc5ac UTSW 7 141813892 splice site probably null
R1599:Muc5ac UTSW 7 141798903 missense possibly damaging 0.52
R1758:Muc5ac UTSW 7 141801531 missense possibly damaging 0.86
R1837:Muc5ac UTSW 7 141807086 missense probably benign 0.00
R1911:Muc5ac UTSW 7 141796304 missense probably benign 0.18
R1922:Muc5ac UTSW 7 141793689 missense probably benign 0.03
R1966:Muc5ac UTSW 7 141803376 missense possibly damaging 0.92
R1994:Muc5ac UTSW 7 141813152 missense possibly damaging 0.93
R2056:Muc5ac UTSW 7 141792035 missense probably benign 0.01
R2126:Muc5ac UTSW 7 141810742 missense possibly damaging 0.84
R2170:Muc5ac UTSW 7 141812347 missense possibly damaging 0.93
R2258:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2259:Muc5ac UTSW 7 141791008 missense probably benign 0.41
R2293:Muc5ac UTSW 7 141807199 missense probably damaging 0.99
R2435:Muc5ac UTSW 7 141818104 missense possibly damaging 0.53
R2895:Muc5ac UTSW 7 141791140 missense possibly damaging 0.92
R2910:Muc5ac UTSW 7 141807641 missense probably damaging 0.99
R3154:Muc5ac UTSW 7 141792736 splice site probably null
R3762:Muc5ac UTSW 7 141807475 missense possibly damaging 0.53
R3791:Muc5ac UTSW 7 141798501 missense probably benign 0.32
R3806:Muc5ac UTSW 7 141813734 missense possibly damaging 0.91
R3825:Muc5ac UTSW 7 141814723 missense possibly damaging 0.92
R3888:Muc5ac UTSW 7 141791224 missense possibly damaging 0.51
R3929:Muc5ac UTSW 7 141802892 missense probably benign
R3981:Muc5ac UTSW 7 141813775 missense possibly damaging 0.86
R4034:Muc5ac UTSW 7 141799844 critical splice donor site probably null
R4043:Muc5ac UTSW 7 141807478 missense possibly damaging 0.53
R4061:Muc5ac UTSW 7 141811130 missense possibly damaging 0.85
R4106:Muc5ac UTSW 7 141802835 missense possibly damaging 0.86
R4206:Muc5ac UTSW 7 141817110 missense possibly damaging 0.73
R4613:Muc5ac UTSW 7 141791103 missense possibly damaging 0.93
R4719:Muc5ac UTSW 7 141789763 missense possibly damaging 0.83
R4751:Muc5ac UTSW 7 141817601 missense probably benign 0.00
R4789:Muc5ac UTSW 7 141798882 missense possibly damaging 0.86
R4928:Muc5ac UTSW 7 141817902 nonsense probably null
R4971:Muc5ac UTSW 7 141816278 missense possibly damaging 0.68
R4982:Muc5ac UTSW 7 141809456 intron probably benign
R5088:Muc5ac UTSW 7 141796319 missense possibly damaging 0.53
R5141:Muc5ac UTSW 7 141814742 missense possibly damaging 0.72
R5224:Muc5ac UTSW 7 141793971 missense probably benign 0.32
R5366:Muc5ac UTSW 7 141807550 missense probably benign 0.01
R5497:Muc5ac UTSW 7 141807643 missense probably damaging 0.99
R5507:Muc5ac UTSW 7 141807832 missense possibly damaging 0.72
R5643:Muc5ac UTSW 7 141793715 critical splice donor site probably null
R5811:Muc5ac UTSW 7 141798984 missense possibly damaging 0.51
R5946:Muc5ac UTSW 7 141817907 missense possibly damaging 0.73
R5970:Muc5ac UTSW 7 141790669 nonsense probably null
R5977:Muc5ac UTSW 7 141796367 missense possibly damaging 0.73
R6051:Muc5ac UTSW 7 141811857 missense possibly damaging 0.53
R6126:Muc5ac UTSW 7 141801232 missense possibly damaging 0.71
R6159:Muc5ac UTSW 7 141815586 missense possibly damaging 0.53
R6256:Muc5ac UTSW 7 141789795 missense possibly damaging 0.53
R6283:Muc5ac UTSW 7 141816864 nonsense probably null
R6341:Muc5ac UTSW 7 141801492 missense probably damaging 0.99
R6356:Muc5ac UTSW 7 141812679 missense probably benign 0.05
R6481:Muc5ac UTSW 7 141809071 intron probably benign
R6483:Muc5ac UTSW 7 141802854 missense probably benign 0.18
R6627:Muc5ac UTSW 7 141808690 intron probably benign
R6636:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6637:Muc5ac UTSW 7 141818605 missense possibly damaging 0.86
R6656:Muc5ac UTSW 7 141803328 missense probably damaging 0.98
R6721:Muc5ac UTSW 7 141798992 missense possibly damaging 0.71
R6794:Muc5ac UTSW 7 141809552 intron probably benign
R6844:Muc5ac UTSW 7 141809744 intron probably benign
R6847:Muc5ac UTSW 7 141809744 intron probably benign
R6852:Muc5ac UTSW 7 141816907 missense probably benign 0.03
R6862:Muc5ac UTSW 7 141809744 intron probably benign
R6863:Muc5ac UTSW 7 141809744 intron probably benign
R6864:Muc5ac UTSW 7 141809744 intron probably benign
R6865:Muc5ac UTSW 7 141809744 intron probably benign
R6874:Muc5ac UTSW 7 141809744 intron probably benign
R6875:Muc5ac UTSW 7 141809744 intron probably benign
R6876:Muc5ac UTSW 7 141809744 intron probably benign
R6877:Muc5ac UTSW 7 141809744 intron probably benign
R6889:Muc5ac UTSW 7 141809744 intron probably benign
R6920:Muc5ac UTSW 7 141793298 missense possibly damaging 0.86
R6998:Muc5ac UTSW 7 141818714 missense possibly damaging 0.92
R7017:Muc5ac UTSW 7 141809687 intron probably benign
R7091:Muc5ac UTSW 7 141809687 intron probably benign
R7092:Muc5ac UTSW 7 141809648 intron probably benign
R7092:Muc5ac UTSW 7 141809687 intron probably benign
R7110:Muc5ac UTSW 7 141799822 missense possibly damaging 0.95
R7117:Muc5ac UTSW 7 141813822 nonsense probably null
R7238:Muc5ac UTSW 7 141809517 missense unknown
R7238:Muc5ac UTSW 7 141809687 intron probably benign
R7396:Muc5ac UTSW 7 141808415 missense unknown
R7456:Muc5ac UTSW 7 141793167 missense probably benign 0.32
R7477:Muc5ac UTSW 7 141816282 missense possibly damaging 0.72
R7530:Muc5ac UTSW 7 141813799 missense possibly damaging 0.51
R7545:Muc5ac UTSW 7 141808668 missense unknown
R7604:Muc5ac UTSW 7 141809709 missense unknown
R7635:Muc5ac UTSW 7 141805676 missense probably damaging 0.98
R7635:Muc5ac UTSW 7 141805753 missense possibly damaging 0.53
R7650:Muc5ac UTSW 7 141809422 missense unknown
R7651:Muc5ac UTSW 7 141796254 missense possibly damaging 0.92
R7685:Muc5ac UTSW 7 141809383 missense unknown
R7720:Muc5ac UTSW 7 141809303 missense unknown
R7749:Muc5ac UTSW 7 141809303 missense unknown
R7750:Muc5ac UTSW 7 141809303 missense unknown
R7751:Muc5ac UTSW 7 141809303 missense unknown
R7754:Muc5ac UTSW 7 141809303 missense unknown
R7798:Muc5ac UTSW 7 141794041 critical splice donor site probably null
R7835:Muc5ac UTSW 7 141809303 missense unknown
R7837:Muc5ac UTSW 7 141815963 missense possibly damaging 0.53
R7858:Muc5ac UTSW 7 141803429 missense possibly damaging 0.51
R7866:Muc5ac UTSW 7 141795852 missense probably benign 0.00
R7874:Muc5ac UTSW 7 141809303 missense unknown
R7876:Muc5ac UTSW 7 141809303 missense unknown
R7877:Muc5ac UTSW 7 141809303 missense unknown
R7881:Muc5ac UTSW 7 141809303 missense unknown
R7884:Muc5ac UTSW 7 141809303 missense unknown
R7921:Muc5ac UTSW 7 141809687 intron probably benign
R7976:Muc5ac UTSW 7 141809791 missense unknown
R8104:Muc5ac UTSW 7 141804783 missense possibly damaging 0.96
R8177:Muc5ac UTSW 7 141807331 missense probably damaging 1.00
R8214:Muc5ac UTSW 7 141802948 missense possibly damaging 0.53
R8292:Muc5ac UTSW 7 141809263 missense unknown
R8386:Muc5ac UTSW 7 141807634 missense possibly damaging 0.93
R8400:Muc5ac UTSW 7 141810476 missense probably damaging 0.99
R8504:Muc5ac UTSW 7 141807155 missense probably damaging 1.00
R8709:Muc5ac UTSW 7 141816926 missense possibly damaging 0.96
R8725:Muc5ac UTSW 7 141809744 intron probably benign
R8727:Muc5ac UTSW 7 141809744 intron probably benign
R8754:Muc5ac UTSW 7 141800271 missense possibly damaging 0.85
R8769:Muc5ac UTSW 7 141818872 missense probably damaging 1.00
R8933:Muc5ac UTSW 7 141789756 missense possibly damaging 0.59
R8939:Muc5ac UTSW 7 141793354 missense probably damaging 0.98
R9049:Muc5ac UTSW 7 141808975 missense unknown
R9124:Muc5ac UTSW 7 141809792 missense unknown
R9131:Muc5ac UTSW 7 141809792 missense unknown
R9132:Muc5ac UTSW 7 141809792 missense unknown
R9135:Muc5ac UTSW 7 141798481 missense probably damaging 0.99
R9156:Muc5ac UTSW 7 141809792 missense unknown
R9157:Muc5ac UTSW 7 141809792 missense unknown
R9159:Muc5ac UTSW 7 141809792 missense unknown
R9160:Muc5ac UTSW 7 141809792 missense unknown
R9161:Muc5ac UTSW 7 141799289 missense possibly damaging 0.53
R9175:Muc5ac UTSW 7 141812356 missense possibly damaging 0.92
R9183:Muc5ac UTSW 7 141798900 missense possibly damaging 0.71
R9218:Muc5ac UTSW 7 141807361 missense probably damaging 0.99
R9219:Muc5ac UTSW 7 141817063 nonsense probably null
R9239:Muc5ac UTSW 7 141800217 missense probably damaging 0.99
R9246:Muc5ac UTSW 7 141810478 missense probably benign 0.11
R9287:Muc5ac UTSW 7 141807889 missense probably damaging 0.99
R9320:Muc5ac UTSW 7 141815518 missense probably benign 0.01
R9327:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
R9428:Muc5ac UTSW 7 141808822 missense unknown
R9430:Muc5ac UTSW 7 141808832 missense unknown
R9454:Muc5ac UTSW 7 141808694 missense unknown
R9483:Muc5ac UTSW 7 141811728 nonsense probably null
R9581:Muc5ac UTSW 7 141810062 missense unknown
R9610:Muc5ac UTSW 7 141796341 missense possibly damaging 0.86
R9642:Muc5ac UTSW 7 141795864 missense possibly damaging 0.71
R9684:Muc5ac UTSW 7 141811061 missense probably benign 0.41
R9760:Muc5ac UTSW 7 141807248 missense probably benign 0.05
R9778:Muc5ac UTSW 7 141795284 nonsense probably null
X0060:Muc5ac UTSW 7 141803333 missense possibly damaging 0.71
Z1088:Muc5ac UTSW 7 141809744 intron probably benign
Z1088:Muc5ac UTSW 7 141811692 missense possibly damaging 0.86
Z1177:Muc5ac UTSW 7 141809224 missense unknown
Z1177:Muc5ac UTSW 7 141818040 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGGGAGAAGTGGCTATCCAAGCTATCA -3'
(R):5'- CGGGTGAGGGTGCCAGACAATCATA -3'

Sequencing Primer
(F):5'- tgttccttactgacttgcttcc -3'
(R):5'- AGACAATCATACCTGTAGCAGTG -3'
Posted On 2013-04-24