Mutagenetix > Incidental Mutations

Incidental Mutation 'R0363:Arel1'

30200

Institutional Source

Beutler Lab

Gene Symbol

Arel1

Ensembl Gene

ENSMUSG00000042350

Gene Name

apoptosis resistant E3 ubiquitin protein ligase 1

Synonyms

1110018G07Rik

MMRRC Submission

038569-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.523) question?

Stock #

R0363 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84918148-84970900 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84934253 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 327 (S327P)

Ref Sequence

ENSEMBL: ENSMUSP00000129213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043169] [ENSMUST00000163231] [ENSMUST00000163372]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043169
AA Change: S327P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000048780
Gene: ENSMUSG00000042350
AA Change: S327P

Domain	Start	End	E-Value	Type
transmembrane domain	2	19	N/A	INTRINSIC
IG_FLMN	56	160	4.53e-2	SMART
low complexity region	346	360	N/A	INTRINSIC
Blast:HECTc	401	474	6e-39	BLAST
HECTc	481	823	1.04e-158	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163231
AA Change: S327P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129213
Gene: ENSMUSG00000042350
AA Change: S327P

Domain	Start	End	E-Value	Type
transmembrane domain	2	19	N/A	INTRINSIC
IG_FLMN	56	160	4.53e-2	SMART
low complexity region	346	360	N/A	INTRINSIC
Blast:HECTc	386	474	1e-51	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000163372

SMART Domains

Protein: ENSMUSP00000130259
Gene: ENSMUSG00000042350

Domain	Start	End	E-Value	Type
transmembrane domain	4	26	N/A	INTRINSIC
Blast:IG_FLMN	56	81	7e-13	BLAST
SCOP:d1qfha1	56	81	4e-6	SMART

Meta Mutation Damage Score

0.0775

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 86.5%

Validation Efficiency

98% (78/80)

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	T	A	4: 109,524,323	Q86L	probably null	Het
5430403G16Rik	T	C	5: 109,676,888	E232G	probably benign	Het
Abhd2	A	G	7: 79,350,813	D262G	possibly damaging	Het
Abhd5	T	C	9: 122,368,146	F133L	possibly damaging	Het
Agap2	T	A	10: 127,090,965	V957E	probably damaging	Het
Ankrd12	T	C	17: 65,985,681	K919R	probably damaging	Het
Ap1m1	T	C	8: 72,252,894	S245P	probably benign	Het
Ap1m1	T	C	8: 72,256,724		probably benign	Het
Apcdd1	A	G	18: 62,937,097	Y145C	possibly damaging	Het
Apob	A	T	12: 8,010,136	N2840Y	probably damaging	Het
Arhgap21	C	A	2: 20,881,133	R421L	probably damaging	Het
Ccdc85a	A	T	11: 28,583,400	I48N	probably damaging	Het
Chd6	A	G	2: 161,014,324	S672P	probably damaging	Het
Ciz1	G	C	2: 32,377,363		probably null	Het
Cmbl	G	A	15: 31,585,442		probably null	Het
Cmya5	A	G	13: 93,094,869	V1237A	possibly damaging	Het
Cntnap4	A	T	8: 112,856,511	K1074*	probably null	Het
Cntnap5b	A	G	1: 100,274,468	M347V	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cuzd1	A	T	7: 131,316,262	M203K	probably benign	Het
Cyp3a16	T	C	5: 145,455,879		probably benign	Het
Dlgap3	A	G	4: 127,235,521	E892G	probably damaging	Het
Dnah7b	T	C	1: 46,236,788	S2612P	probably damaging	Het
Epas1	T	G	17: 86,805,848		probably benign	Het
Etv5	G	A	16: 22,411,708	A192V	probably benign	Het
Fa2h	T	A	8: 111,349,289	H234L	probably damaging	Het
Fcho1	T	C	8: 71,717,490	Y47C	probably damaging	Het
Flvcr1	T	A	1: 191,012,254		probably benign	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Inpp4b	T	C	8: 81,884,257		probably benign	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Kmt2a	A	G	9: 44,809,713		probably null	Het
Krt4	G	A	15: 101,924,646	R9C	possibly damaging	Het
Map1a	T	C	2: 121,302,044	S876P	probably damaging	Het
Mettl21e	A	G	1: 44,211,030		probably null	Het
Msh2	C	T	17: 87,717,476	T594M	probably benign	Het
Mtmr3	A	G	11: 4,487,536	S973P	probably damaging	Het
Muc5ac	A	T	7: 141,800,960	M889L	probably benign	Het
Ntn1	A	G	11: 68,385,543	I193T	probably benign	Het
Nudt13	A	T	14: 20,309,783	I193F	probably damaging	Het
Olfr1272	A	T	2: 90,281,856	S240T	probably damaging	Het
Olfr134	A	G	17: 38,175,447	D121G	probably damaging	Het
Olfr410	C	T	11: 74,335,099	G44D	probably damaging	Het
Olfr498	A	T	7: 108,465,734	T137S	possibly damaging	Het
Otulin	A	G	15: 27,606,295	V344A	probably damaging	Het
P2rx7	C	T	5: 122,657,030	Q128*	probably null	Het
Pcdhb22	G	A	18: 37,519,160	R227H	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Pltp	C	T	2: 164,840,136	R394H	probably benign	Het
Ppip5k1	C	G	2: 121,347,355	A324P	probably damaging	Het
Pramef17	C	T	4: 143,991,651	M407I	probably benign	Het
Prdm13	A	C	4: 21,679,737	V251G	unknown	Het
Prkg1	T	C	19: 31,664,196	E29G	probably damaging	Het
Prrc2c	A	G	1: 162,697,811	S409P	unknown	Het
Rp1	T	A	1: 4,347,718	D1057V	probably damaging	Het
Rttn	G	A	18: 89,010,955	C599Y	probably damaging	Het
Shisa6	C	T	11: 66,525,327	R213Q	probably benign	Het
Slc3a1	T	C	17: 85,032,845	Y232H	probably damaging	Het
Slx4	G	A	16: 3,980,089	A1477V	probably damaging	Het
Ssrp1	T	G	2: 85,040,674	I218S	probably damaging	Het
St6galnac1	A	C	11: 116,768,930	S186A	probably benign	Het
Stab1	A	G	14: 31,159,008		probably benign	Het
Sycp2	T	C	2: 178,346,411		probably benign	Het
Syne2	T	A	12: 76,072,207	I5867N	probably damaging	Het
Taar7f	T	A	10: 24,049,941	D144E	probably damaging	Het
Tmem136	A	T	9: 43,111,753	M84K	probably damaging	Het
Tmem87b	T	A	2: 128,831,233	S196T	probably damaging	Het
Tnfrsf21	A	G	17: 43,037,877	T127A	probably benign	Het
Trp73	A	G	4: 154,063,949	I336T	probably benign	Het
Ttl	A	G	2: 129,076,061	I148V	probably damaging	Het
Ttll7	T	C	3: 146,944,215	Y667H	probably benign	Het
Ubr4	A	G	4: 139,391,860	T152A	probably damaging	Het
Vmn1r58	A	T	7: 5,410,637	V198E	probably damaging	Het
Vps52	T	A	17: 33,962,117	F376L	probably benign	Het

Other mutations in Arel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00928:Arel1	APN	12	84934162	missense	probably damaging	0.98
IGL01532:Arel1	APN	12	84934162	missense	possibly damaging	0.46
IGL01640:Arel1	APN	12	84920701	missense	probably damaging	1.00
IGL02522:Arel1	APN	12	84927910	missense	probably damaging	1.00
IGL02675:Arel1	APN	12	84930228	missense	probably damaging	1.00
IGL02867:Arel1	APN	12	84934323	missense	probably benign	0.01
IGL03231:Arel1	APN	12	84934310	missense	probably benign
R0244:Arel1	UTSW	12	84920693	missense	probably damaging	0.99
R0538:Arel1	UTSW	12	84941837	missense	probably damaging	1.00
R1633:Arel1	UTSW	12	84926283	missense	probably damaging	1.00
R1965:Arel1	UTSW	12	84940399	critical splice acceptor site	probably null
R2161:Arel1	UTSW	12	84921256	critical splice donor site	probably null
R4691:Arel1	UTSW	12	84930249	splice site	probably null
R4958:Arel1	UTSW	12	84926304	missense	possibly damaging	0.89
R4999:Arel1	UTSW	12	84931767	missense	probably damaging	0.99
R5088:Arel1	UTSW	12	84924115	missense	probably damaging	1.00
R5154:Arel1	UTSW	12	84931773	missense	probably benign
R5939:Arel1	UTSW	12	84926292	missense	probably damaging	0.99
R5945:Arel1	UTSW	12	84926347	missense	probably benign	0.20
R6118:Arel1	UTSW	12	84941939	missense	possibly damaging	0.46
R6421:Arel1	UTSW	12	84934345	missense	probably damaging	1.00
R6458:Arel1	UTSW	12	84940385	missense	possibly damaging	0.87
R7290:Arel1	UTSW	12	84941945	missense	probably benign	0.08
R7490:Arel1	UTSW	12	84941911	missense	probably damaging	0.97
R7732:Arel1	UTSW	12	84927889	missense	probably benign	0.45
R7743:Arel1	UTSW	12	84940269	missense	probably damaging	1.00
R8021:Arel1	UTSW	12	84934958	missense	possibly damaging	0.47
R8083:Arel1	UTSW	12	84940362	missense	probably benign	0.00
X0066:Arel1	UTSW	12	84934382	missense	probably damaging	0.99
X0066:Arel1	UTSW	12	84943329	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- CCAGGCTGTCACTTCAGAGTTTCC -3'
(R):5'- ATTCCCGAGGTTGCTTCCATGC -3'

Sequencing Primer
(F):5'- AGAGTTTCCATTACTACACTGGC -3'
(R):5'- GCCTTGTAGTACATGAAGTGACC -3'

Posted On

2013-04-24