Incidental Mutation 'R0363:Arel1'
ID30200
Institutional Source Beutler Lab
Gene Symbol Arel1
Ensembl Gene ENSMUSG00000042350
Gene Nameapoptosis resistant E3 ubiquitin protein ligase 1
Synonyms1110018G07Rik
MMRRC Submission 038569-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.523) question?
Stock #R0363 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84918148-84970900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84934253 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 327 (S327P)
Ref Sequence ENSEMBL: ENSMUSP00000129213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043169] [ENSMUST00000163231] [ENSMUST00000163372]
Predicted Effect probably damaging
Transcript: ENSMUST00000043169
AA Change: S327P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048780
Gene: ENSMUSG00000042350
AA Change: S327P

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 401 474 6e-39 BLAST
HECTc 481 823 1.04e-158 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163231
AA Change: S327P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129213
Gene: ENSMUSG00000042350
AA Change: S327P

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
IG_FLMN 56 160 4.53e-2 SMART
low complexity region 346 360 N/A INTRINSIC
Blast:HECTc 386 474 1e-51 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163372
SMART Domains Protein: ENSMUSP00000130259
Gene: ENSMUSG00000042350

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Blast:IG_FLMN 56 81 7e-13 BLAST
SCOP:d1qfha1 56 81 4e-6 SMART
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 86.5%
Validation Efficiency 98% (78/80)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik T A 4: 109,524,323 Q86L probably null Het
5430403G16Rik T C 5: 109,676,888 E232G probably benign Het
Abhd2 A G 7: 79,350,813 D262G possibly damaging Het
Abhd5 T C 9: 122,368,146 F133L possibly damaging Het
Agap2 T A 10: 127,090,965 V957E probably damaging Het
Ankrd12 T C 17: 65,985,681 K919R probably damaging Het
Ap1m1 T C 8: 72,252,894 S245P probably benign Het
Ap1m1 T C 8: 72,256,724 probably benign Het
Apcdd1 A G 18: 62,937,097 Y145C possibly damaging Het
Apob A T 12: 8,010,136 N2840Y probably damaging Het
Arhgap21 C A 2: 20,881,133 R421L probably damaging Het
Ccdc85a A T 11: 28,583,400 I48N probably damaging Het
Chd6 A G 2: 161,014,324 S672P probably damaging Het
Ciz1 G C 2: 32,377,363 probably null Het
Cmbl G A 15: 31,585,442 probably null Het
Cmya5 A G 13: 93,094,869 V1237A possibly damaging Het
Cntnap4 A T 8: 112,856,511 K1074* probably null Het
Cntnap5b A G 1: 100,274,468 M347V probably benign Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cuzd1 A T 7: 131,316,262 M203K probably benign Het
Cyp3a16 T C 5: 145,455,879 probably benign Het
Dlgap3 A G 4: 127,235,521 E892G probably damaging Het
Dnah7b T C 1: 46,236,788 S2612P probably damaging Het
Epas1 T G 17: 86,805,848 probably benign Het
Etv5 G A 16: 22,411,708 A192V probably benign Het
Fa2h T A 8: 111,349,289 H234L probably damaging Het
Fcho1 T C 8: 71,717,490 Y47C probably damaging Het
Flvcr1 T A 1: 191,012,254 probably benign Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Inpp4b T C 8: 81,884,257 probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kmt2a A G 9: 44,809,713 probably null Het
Krt4 G A 15: 101,924,646 R9C possibly damaging Het
Map1a T C 2: 121,302,044 S876P probably damaging Het
Mettl21e A G 1: 44,211,030 probably null Het
Msh2 C T 17: 87,717,476 T594M probably benign Het
Mtmr3 A G 11: 4,487,536 S973P probably damaging Het
Muc5ac A T 7: 141,800,960 M889L probably benign Het
Ntn1 A G 11: 68,385,543 I193T probably benign Het
Nudt13 A T 14: 20,309,783 I193F probably damaging Het
Olfr1272 A T 2: 90,281,856 S240T probably damaging Het
Olfr134 A G 17: 38,175,447 D121G probably damaging Het
Olfr410 C T 11: 74,335,099 G44D probably damaging Het
Olfr498 A T 7: 108,465,734 T137S possibly damaging Het
Otulin A G 15: 27,606,295 V344A probably damaging Het
P2rx7 C T 5: 122,657,030 Q128* probably null Het
Pcdhb22 G A 18: 37,519,160 R227H probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Pltp C T 2: 164,840,136 R394H probably benign Het
Ppip5k1 C G 2: 121,347,355 A324P probably damaging Het
Pramef17 C T 4: 143,991,651 M407I probably benign Het
Prdm13 A C 4: 21,679,737 V251G unknown Het
Prkg1 T C 19: 31,664,196 E29G probably damaging Het
Prrc2c A G 1: 162,697,811 S409P unknown Het
Rp1 T A 1: 4,347,718 D1057V probably damaging Het
Rttn G A 18: 89,010,955 C599Y probably damaging Het
Shisa6 C T 11: 66,525,327 R213Q probably benign Het
Slc3a1 T C 17: 85,032,845 Y232H probably damaging Het
Slx4 G A 16: 3,980,089 A1477V probably damaging Het
Ssrp1 T G 2: 85,040,674 I218S probably damaging Het
St6galnac1 A C 11: 116,768,930 S186A probably benign Het
Stab1 A G 14: 31,159,008 probably benign Het
Sycp2 T C 2: 178,346,411 probably benign Het
Syne2 T A 12: 76,072,207 I5867N probably damaging Het
Taar7f T A 10: 24,049,941 D144E probably damaging Het
Tmem136 A T 9: 43,111,753 M84K probably damaging Het
Tmem87b T A 2: 128,831,233 S196T probably damaging Het
Tnfrsf21 A G 17: 43,037,877 T127A probably benign Het
Trp73 A G 4: 154,063,949 I336T probably benign Het
Ttl A G 2: 129,076,061 I148V probably damaging Het
Ttll7 T C 3: 146,944,215 Y667H probably benign Het
Ubr4 A G 4: 139,391,860 T152A probably damaging Het
Vmn1r58 A T 7: 5,410,637 V198E probably damaging Het
Vps52 T A 17: 33,962,117 F376L probably benign Het
Other mutations in Arel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Arel1 APN 12 84934162 missense probably damaging 0.98
IGL01532:Arel1 APN 12 84934162 missense possibly damaging 0.46
IGL01640:Arel1 APN 12 84920701 missense probably damaging 1.00
IGL02522:Arel1 APN 12 84927910 missense probably damaging 1.00
IGL02675:Arel1 APN 12 84930228 missense probably damaging 1.00
IGL02867:Arel1 APN 12 84934323 missense probably benign 0.01
IGL03231:Arel1 APN 12 84934310 missense probably benign
R0244:Arel1 UTSW 12 84920693 missense probably damaging 0.99
R0538:Arel1 UTSW 12 84941837 missense probably damaging 1.00
R1633:Arel1 UTSW 12 84926283 missense probably damaging 1.00
R1965:Arel1 UTSW 12 84940399 critical splice acceptor site probably null
R2161:Arel1 UTSW 12 84921256 critical splice donor site probably null
R4691:Arel1 UTSW 12 84930249 splice site probably null
R4958:Arel1 UTSW 12 84926304 missense possibly damaging 0.89
R4999:Arel1 UTSW 12 84931767 missense probably damaging 0.99
R5088:Arel1 UTSW 12 84924115 missense probably damaging 1.00
R5154:Arel1 UTSW 12 84931773 missense probably benign
R5939:Arel1 UTSW 12 84926292 missense probably damaging 0.99
R5945:Arel1 UTSW 12 84926347 missense probably benign 0.20
R6118:Arel1 UTSW 12 84941939 missense possibly damaging 0.46
R6421:Arel1 UTSW 12 84934345 missense probably damaging 1.00
R6458:Arel1 UTSW 12 84940385 missense possibly damaging 0.87
R7290:Arel1 UTSW 12 84941945 missense probably benign 0.08
R7490:Arel1 UTSW 12 84941911 missense probably damaging 0.97
R7732:Arel1 UTSW 12 84927889 missense probably benign 0.45
R7743:Arel1 UTSW 12 84940269 missense probably damaging 1.00
R8021:Arel1 UTSW 12 84934958 missense possibly damaging 0.47
R8083:Arel1 UTSW 12 84940362 missense probably benign 0.00
X0066:Arel1 UTSW 12 84934382 missense probably damaging 0.99
X0066:Arel1 UTSW 12 84943329 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGGCTGTCACTTCAGAGTTTCC -3'
(R):5'- ATTCCCGAGGTTGCTTCCATGC -3'

Sequencing Primer
(F):5'- AGAGTTTCCATTACTACACTGGC -3'
(R):5'- GCCTTGTAGTACATGAAGTGACC -3'
Posted On2013-04-24