Mutagenetix > Incidental Mutations

Incidental Mutation 'R0363:Vps52'

30208

Institutional Source

Beutler Lab

Gene Symbol

Vps52

Ensembl Gene

ENSMUSG00000024319

Gene Name

VPS52 GARP complex subunit

Synonyms

tclw5, ARE1, Sacm2l, D430041K17Rik, tcl-w5

MMRRC Submission

038569-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0363 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33955812-33966984 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33962117 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 376 (F376L)

Ref Sequence

ENSEMBL: ENSMUSP00000133926 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025178] [ENSMUST00000173196]

Predicted Effect

probably benign
Transcript: ENSMUST00000025178
AA Change: F444L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319
AA Change: F444L

Domain	Start	End	E-Value	Type
low complexity region	1	11	N/A	INTRINSIC
low complexity region	24	45	N/A	INTRINSIC
Pfam:Sec3_C	79	244	4.6e-13	PFAM
Pfam:Vps52	94	601	5.1e-233	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172558

Predicted Effect

probably benign
Transcript: ENSMUST00000173196
AA Change: F376L

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133926
Gene: ENSMUSG00000024319
AA Change: F376L

Domain	Start	End	E-Value	Type
low complexity region	18	39	N/A	INTRINSIC
Pfam:Vps52	88	120	2.7e-6	PFAM
Pfam:Vps52	116	527	3e-181	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173318

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173445

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174588

Meta Mutation Damage Score

0.2488

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 86.5%

Validation Efficiency

98% (78/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the yeast suppressor of actin mutations 2 gene. The yeast protein forms a subunit of the tetrameric Golgi-associated retrograde protein complex that is involved in vesicle trafficking from from both early and late endosomes, back to the trans-Golgi network. This gene is located on chromosome 6 in a head-to-head orientation with the gene encoding ribosomal protein S18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a null mutation display early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	T	A	4: 109,524,323	Q86L	probably null	Het
5430403G16Rik	T	C	5: 109,676,888	E232G	probably benign	Het
Abhd2	A	G	7: 79,350,813	D262G	possibly damaging	Het
Abhd5	T	C	9: 122,368,146	F133L	possibly damaging	Het
Agap2	T	A	10: 127,090,965	V957E	probably damaging	Het
Ankrd12	T	C	17: 65,985,681	K919R	probably damaging	Het
Ap1m1	T	C	8: 72,256,724		probably benign	Het
Ap1m1	T	C	8: 72,252,894	S245P	probably benign	Het
Apcdd1	A	G	18: 62,937,097	Y145C	possibly damaging	Het
Apob	A	T	12: 8,010,136	N2840Y	probably damaging	Het
Arel1	A	G	12: 84,934,253	S327P	probably damaging	Het
Arhgap21	C	A	2: 20,881,133	R421L	probably damaging	Het
Ccdc85a	A	T	11: 28,583,400	I48N	probably damaging	Het
Chd6	A	G	2: 161,014,324	S672P	probably damaging	Het
Ciz1	G	C	2: 32,377,363		probably null	Het
Cmbl	G	A	15: 31,585,442		probably null	Het
Cmya5	A	G	13: 93,094,869	V1237A	possibly damaging	Het
Cntnap4	A	T	8: 112,856,511	K1074*	probably null	Het
Cntnap5b	A	G	1: 100,274,468	M347V	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cuzd1	A	T	7: 131,316,262	M203K	probably benign	Het
Cyp3a16	T	C	5: 145,455,879		probably benign	Het
Dlgap3	A	G	4: 127,235,521	E892G	probably damaging	Het
Dnah7b	T	C	1: 46,236,788	S2612P	probably damaging	Het
Epas1	T	G	17: 86,805,848		probably benign	Het
Etv5	G	A	16: 22,411,708	A192V	probably benign	Het
Fa2h	T	A	8: 111,349,289	H234L	probably damaging	Het
Fcho1	T	C	8: 71,717,490	Y47C	probably damaging	Het
Flvcr1	T	A	1: 191,012,254		probably benign	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Inpp4b	T	C	8: 81,884,257		probably benign	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Kmt2a	A	G	9: 44,809,713		probably null	Het
Krt4	G	A	15: 101,924,646	R9C	possibly damaging	Het
Map1a	T	C	2: 121,302,044	S876P	probably damaging	Het
Mettl21e	A	G	1: 44,211,030		probably null	Het
Msh2	C	T	17: 87,717,476	T594M	probably benign	Het
Mtmr3	A	G	11: 4,487,536	S973P	probably damaging	Het
Muc5ac	A	T	7: 141,800,960	M889L	probably benign	Het
Ntn1	A	G	11: 68,385,543	I193T	probably benign	Het
Nudt13	A	T	14: 20,309,783	I193F	probably damaging	Het
Olfr1272	A	T	2: 90,281,856	S240T	probably damaging	Het
Olfr134	A	G	17: 38,175,447	D121G	probably damaging	Het
Olfr410	C	T	11: 74,335,099	G44D	probably damaging	Het
Olfr498	A	T	7: 108,465,734	T137S	possibly damaging	Het
Otulin	A	G	15: 27,606,295	V344A	probably damaging	Het
P2rx7	C	T	5: 122,657,030	Q128*	probably null	Het
Pcdhb22	G	A	18: 37,519,160	R227H	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Pltp	C	T	2: 164,840,136	R394H	probably benign	Het
Ppip5k1	C	G	2: 121,347,355	A324P	probably damaging	Het
Pramef17	C	T	4: 143,991,651	M407I	probably benign	Het
Prdm13	A	C	4: 21,679,737	V251G	unknown	Het
Prkg1	T	C	19: 31,664,196	E29G	probably damaging	Het
Prrc2c	A	G	1: 162,697,811	S409P	unknown	Het
Rp1	T	A	1: 4,347,718	D1057V	probably damaging	Het
Rttn	G	A	18: 89,010,955	C599Y	probably damaging	Het
Shisa6	C	T	11: 66,525,327	R213Q	probably benign	Het
Slc3a1	T	C	17: 85,032,845	Y232H	probably damaging	Het
Slx4	G	A	16: 3,980,089	A1477V	probably damaging	Het
Ssrp1	T	G	2: 85,040,674	I218S	probably damaging	Het
St6galnac1	A	C	11: 116,768,930	S186A	probably benign	Het
Stab1	A	G	14: 31,159,008		probably benign	Het
Sycp2	T	C	2: 178,346,411		probably benign	Het
Syne2	T	A	12: 76,072,207	I5867N	probably damaging	Het
Taar7f	T	A	10: 24,049,941	D144E	probably damaging	Het
Tmem136	A	T	9: 43,111,753	M84K	probably damaging	Het
Tmem87b	T	A	2: 128,831,233	S196T	probably damaging	Het
Tnfrsf21	A	G	17: 43,037,877	T127A	probably benign	Het
Trp73	A	G	4: 154,063,949	I336T	probably benign	Het
Ttl	A	G	2: 129,076,061	I148V	probably damaging	Het
Ttll7	T	C	3: 146,944,215	Y667H	probably benign	Het
Ubr4	A	G	4: 139,391,860	T152A	probably damaging	Het
Vmn1r58	A	T	7: 5,410,637	V198E	probably damaging	Het

Other mutations in Vps52

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Vps52	APN	17	33956958	missense	possibly damaging	0.96
IGL01098:Vps52	APN	17	33962730	missense	possibly damaging	0.90
IGL01705:Vps52	APN	17	33966068	missense	probably damaging	1.00
IGL01722:Vps52	APN	17	33961615	nonsense	probably null
IGL02992:Vps52	APN	17	33958350	missense	probably damaging	0.97
IGL03279:Vps52	APN	17	33957874	missense	probably damaging	0.96
R0762:Vps52	UTSW	17	33960011	missense	probably damaging	1.00
R1065:Vps52	UTSW	17	33961239	missense	probably benign	0.02
R1506:Vps52	UTSW	17	33957894	missense	probably damaging	1.00
R3760:Vps52	UTSW	17	33960188	missense	possibly damaging	0.64
R4714:Vps52	UTSW	17	33961179	missense	probably benign	0.25
R5381:Vps52	UTSW	17	33958301	missense	possibly damaging	0.77
R5590:Vps52	UTSW	17	33961221	missense	probably benign	0.01
R5928:Vps52	UTSW	17	33961126	missense	possibly damaging	0.85
R6003:Vps52	UTSW	17	33956094	start codon destroyed	probably null	0.01
R6302:Vps52	UTSW	17	33963215	missense	probably damaging	1.00
R6574:Vps52	UTSW	17	33962478	missense	probably null	0.34
R6695:Vps52	UTSW	17	33963199	nonsense	probably null
R6888:Vps52	UTSW	17	33963206	missense	probably benign	0.06
R7022:Vps52	UTSW	17	33959319	missense	probably benign	0.04
R7136:Vps52	UTSW	17	33965288	missense	probably benign	0.00
R7380:Vps52	UTSW	17	33958309	missense	possibly damaging	0.82
R7727:Vps52	UTSW	17	33962134	missense	probably benign	0.21
R7888:Vps52	UTSW	17	33965751	missense	probably damaging	0.98
R8385:Vps52	UTSW	17	33962817	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGTTCTCTAAGCCTTGGCCCTG -3'
(R):5'- AACCTTGCTCGCCCTTACATAGTG -3'

Sequencing Primer
(F):5'- ACATAAGTGTGGCTGTGAGC -3'
(R):5'- TGGACATTCATCTCCAGGATCAG -3'

Posted On

2013-04-24