Mutagenetix > Incidental Mutations

Incidental Mutation 'R0363:Tnfrsf21'

30210

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

038569-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R0363 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43037877 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 127 (T127A)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

AlphaFold

Q9EPU5

Predicted Effect

probably benign
Transcript: ENSMUST00000024708
AA Change: T127A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: T127A

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Meta Mutation Damage Score

0.0613

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 86.5%

Validation Efficiency

98% (78/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522H14Rik	T	A	4: 109,524,323	Q86L	probably null	Het
5430403G16Rik	T	C	5: 109,676,888	E232G	probably benign	Het
Abhd2	A	G	7: 79,350,813	D262G	possibly damaging	Het
Abhd5	T	C	9: 122,368,146	F133L	possibly damaging	Het
Agap2	T	A	10: 127,090,965	V957E	probably damaging	Het
Ankrd12	T	C	17: 65,985,681	K919R	probably damaging	Het
Ap1m1	T	C	8: 72,256,724		probably benign	Het
Ap1m1	T	C	8: 72,252,894	S245P	probably benign	Het
Apcdd1	A	G	18: 62,937,097	Y145C	possibly damaging	Het
Apob	A	T	12: 8,010,136	N2840Y	probably damaging	Het
Arel1	A	G	12: 84,934,253	S327P	probably damaging	Het
Arhgap21	C	A	2: 20,881,133	R421L	probably damaging	Het
Ccdc85a	A	T	11: 28,583,400	I48N	probably damaging	Het
Chd6	A	G	2: 161,014,324	S672P	probably damaging	Het
Ciz1	G	C	2: 32,377,363		probably null	Het
Cmbl	G	A	15: 31,585,442		probably null	Het
Cmya5	A	G	13: 93,094,869	V1237A	possibly damaging	Het
Cntnap4	A	T	8: 112,856,511	K1074*	probably null	Het
Cntnap5b	A	G	1: 100,274,468	M347V	probably benign	Het
Col1a2	G	A	6: 4,518,822		probably benign	Het
Cuzd1	A	T	7: 131,316,262	M203K	probably benign	Het
Cyp3a16	T	C	5: 145,455,879		probably benign	Het
Dlgap3	A	G	4: 127,235,521	E892G	probably damaging	Het
Dnah7b	T	C	1: 46,236,788	S2612P	probably damaging	Het
Epas1	T	G	17: 86,805,848		probably benign	Het
Etv5	G	A	16: 22,411,708	A192V	probably benign	Het
Fa2h	T	A	8: 111,349,289	H234L	probably damaging	Het
Fcho1	T	C	8: 71,717,490	Y47C	probably damaging	Het
Flvcr1	T	A	1: 191,012,254		probably benign	Het
Il1rl1	CTTGTTGTTGTTGTTGTTG	CTTGTTGTTGTTGTTGTTGTTG	1: 40,442,574		probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Inpp4b	T	C	8: 81,884,257		probably benign	Het
Isy1	G	A	6: 87,819,185	R257W	probably damaging	Het
Kmt2a	A	G	9: 44,809,713		probably null	Het
Krt4	G	A	15: 101,924,646	R9C	possibly damaging	Het
Map1a	T	C	2: 121,302,044	S876P	probably damaging	Het
Mettl21e	A	G	1: 44,211,030		probably null	Het
Msh2	C	T	17: 87,717,476	T594M	probably benign	Het
Mtmr3	A	G	11: 4,487,536	S973P	probably damaging	Het
Muc5ac	A	T	7: 141,800,960	M889L	probably benign	Het
Ntn1	A	G	11: 68,385,543	I193T	probably benign	Het
Nudt13	A	T	14: 20,309,783	I193F	probably damaging	Het
Olfr1272	A	T	2: 90,281,856	S240T	probably damaging	Het
Olfr134	A	G	17: 38,175,447	D121G	probably damaging	Het
Olfr410	C	T	11: 74,335,099	G44D	probably damaging	Het
Olfr498	A	T	7: 108,465,734	T137S	possibly damaging	Het
Otulin	A	G	15: 27,606,295	V344A	probably damaging	Het
P2rx7	C	T	5: 122,657,030	Q128*	probably null	Het
Pcdhb22	G	A	18: 37,519,160	R227H	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Pltp	C	T	2: 164,840,136	R394H	probably benign	Het
Ppip5k1	C	G	2: 121,347,355	A324P	probably damaging	Het
Pramef17	C	T	4: 143,991,651	M407I	probably benign	Het
Prdm13	A	C	4: 21,679,737	V251G	unknown	Het
Prkg1	T	C	19: 31,664,196	E29G	probably damaging	Het
Prrc2c	A	G	1: 162,697,811	S409P	unknown	Het
Rp1	T	A	1: 4,347,718	D1057V	probably damaging	Het
Rttn	G	A	18: 89,010,955	C599Y	probably damaging	Het
Shisa6	C	T	11: 66,525,327	R213Q	probably benign	Het
Slc3a1	T	C	17: 85,032,845	Y232H	probably damaging	Het
Slx4	G	A	16: 3,980,089	A1477V	probably damaging	Het
Ssrp1	T	G	2: 85,040,674	I218S	probably damaging	Het
St6galnac1	A	C	11: 116,768,930	S186A	probably benign	Het
Stab1	A	G	14: 31,159,008		probably benign	Het
Sycp2	T	C	2: 178,346,411		probably benign	Het
Syne2	T	A	12: 76,072,207	I5867N	probably damaging	Het
Taar7f	T	A	10: 24,049,941	D144E	probably damaging	Het
Tmem136	A	T	9: 43,111,753	M84K	probably damaging	Het
Tmem87b	T	A	2: 128,831,233	S196T	probably damaging	Het
Trp73	A	G	4: 154,063,949	I336T	probably benign	Het
Ttl	A	G	2: 129,076,061	I148V	probably damaging	Het
Ttll7	T	C	3: 146,944,215	Y667H	probably benign	Het
Ubr4	A	G	4: 139,391,860	T152A	probably damaging	Het
Vmn1r58	A	T	7: 5,410,637	V198E	probably damaging	Het
Vps52	T	A	17: 33,962,117	F376L	probably benign	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0046:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0523:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0550:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R2323:Tnfrsf21	UTSW	17	43085529	nonsense	probably null
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R4811:Tnfrsf21	UTSW	17	43037730	missense	probably benign	0.00
R5437:Tnfrsf21	UTSW	17	43037862	missense	possibly damaging	0.55
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
R8495:Tnfrsf21	UTSW	17	43038237	missense	probably benign
R8865:Tnfrsf21	UTSW	17	43085481	missense	probably damaging	1.00
R8991:Tnfrsf21	UTSW	17	43085408	missense	probably benign	0.03
R9088:Tnfrsf21	UTSW	17	43037716	missense	probably damaging	1.00
R9150:Tnfrsf21	UTSW	17	43087800	missense	probably damaging	1.00
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTTGGATTCCTCAGCACCATCAC -3'
(R):5'- ATCACACTGGAAGGCACGTCAGAG -3'

Sequencing Primer
(F):5'- TGCTAACCTGCGACAAGTG -3'
(R):5'- ACTGCTTACAGCGCACAT -3'

Posted On

2013-04-24